ID: 1001345754

View in Genome Browser
Species Human (GRCh38)
Location 5:170896909-170896931
Sequence CATTCTGGTGCATAGTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001345754_1001345762 24 Left 1001345754 5:170896909-170896931 CCAGCTGACTATGCACCAGAATG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1001345762 5:170896956-170896978 GGCCAGTGCGAAAACCAGATTGG 0: 1
1: 1
2: 5
3: 24
4: 138
1001345754_1001345758 -1 Left 1001345754 5:170896909-170896931 CCAGCTGACTATGCACCAGAATG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1001345754_1001345756 -10 Left 1001345754 5:170896909-170896931 CCAGCTGACTATGCACCAGAATG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1001345756 5:170896922-170896944 CACCAGAATGACCCAGTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 121
1001345754_1001345761 3 Left 1001345754 5:170896909-170896931 CCAGCTGACTATGCACCAGAATG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1001345761 5:170896935-170896957 CAGTTGGTGGTCATACTGGTTGG 0: 1
1: 0
2: 0
3: 12
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001345754 Original CRISPR CATTCTGGTGCATAGTCAGC TGG (reversed) Intronic
902220607 1:14962183-14962205 CTTTCTGGGGGATAGTCAGCTGG - Intronic
904614467 1:31742552-31742574 CATTTTGGTGCATGGCCAGCTGG - Intronic
906748909 1:48241465-48241487 CTTTCTGGTGCATGTTGAGCTGG - Intronic
907177165 1:52535098-52535120 CATCTTGTTGCATAGTCAGCTGG + Intronic
908042845 1:60133665-60133687 CGTTCTGGTGCATAAACAGGTGG - Intergenic
915752750 1:158227516-158227538 CACTATGGTGCCTAGACAGCTGG - Intergenic
920845228 1:209588083-209588105 CACTCTGGGGCATAGTGAGCAGG - Intronic
920987035 1:210900634-210900656 AATTCTGGTGCATAAACAGTGGG + Intronic
1064916787 10:20467060-20467082 CATTCTGGTGCAATGTCATTTGG - Intergenic
1074808074 10:117073930-117073952 CATTCTGGGATATAGGCAGCGGG - Intronic
1078843733 11:15103165-15103187 CATTCTGCTGAATGGTCATCTGG - Intergenic
1083840634 11:65302251-65302273 CATTTTCGTGCTGAGTCAGCAGG + Intronic
1086429922 11:86726741-86726763 GATTTTGGTGGATAGTCAGATGG + Intergenic
1101432555 12:104638652-104638674 CATTCTTCTGCAAAGTTAGCAGG - Intronic
1103145867 12:118595363-118595385 CATCCTTGTGAATAGACAGCTGG - Intergenic
1105304401 13:19158765-19158787 CATTCTGCCTCATAGTCACCAGG + Intergenic
1105977519 13:25485567-25485589 CATTCTAGTCCACAGTGAGCTGG + Intronic
1109414075 13:62012342-62012364 AATTCTGAAGCATAGTCAGATGG + Intergenic
1116209940 14:41924717-41924739 GATTCTGGTGCTCAGTCAGATGG + Intergenic
1117278495 14:54213770-54213792 CATTTTGATGCAGTGTCAGCAGG - Intergenic
1117484623 14:56181906-56181928 CATTCTGTTGCATAGGCATAGGG + Intronic
1123843122 15:24269317-24269339 CTTCCTGGCTCATAGTCAGCGGG - Intergenic
1131091840 15:89629417-89629439 CCTTCTGCTGCAGGGTCAGCTGG + Exonic
1138277668 16:55747839-55747861 AATTATGGTTTATAGTCAGCAGG + Intergenic
1146352136 17:32103771-32103793 GCTACTGGGGCATAGTCAGCTGG + Intergenic
1150701822 17:67453872-67453894 CATTCTGGTGAATTCTCAGGAGG - Intronic
1151832758 17:76564901-76564923 CATTCTGCTGCCTGGACAGCAGG - Intronic
1153088244 18:1314164-1314186 CATTTTCTTGCATAGTTAGCTGG + Intergenic
1154486608 18:14876764-14876786 CACTCTGGTGCATTTTAAGCAGG - Intergenic
1155779113 18:29808748-29808770 CATTCAGCTGAATACTCAGCAGG - Intergenic
1156326819 18:36081137-36081159 CATTCAGGCACATAGTCATCAGG + Intergenic
1162172643 19:8803533-8803555 CATTGTGGTGCACAGACAGAAGG + Intergenic
1166792704 19:45407213-45407235 CATTCTGGGGCAAAGTCTGCAGG - Exonic
927113520 2:19880860-19880882 CATTCTCTTCCCTAGTCAGCTGG - Intergenic
929044167 2:37774365-37774387 TATACTGGTGATTAGTCAGCGGG - Intergenic
932253360 2:70263585-70263607 CATGGTGCTGCATACTCAGCAGG + Intronic
936450951 2:112633734-112633756 CTTTCTGGTTCATAGACAGCTGG - Intergenic
937421893 2:121764107-121764129 CATTCTGGTGCCTTGCCTGCAGG + Intronic
940372426 2:152918146-152918168 CATGGTGGTGCATTGTCTGCAGG + Intergenic
943115581 2:183665725-183665747 CAATCTGGTCCATAGACAGGTGG - Intergenic
944139979 2:196445674-196445696 CATTATGGGGCATGATCAGCAGG + Intronic
946555754 2:220855314-220855336 CTTTCTGGTGGATAGTAATCAGG + Intergenic
1170321908 20:15109503-15109525 CTTTCTGGGGCACAGTCAGGTGG - Intronic
1172207476 20:33174183-33174205 GATTCTAGTGCATACTCACCCGG - Exonic
1174006192 20:47412665-47412687 CATTCTGTTGCATAGGCTGGAGG - Intergenic
1175665101 20:60852027-60852049 CAGGCTGGTGCAAAGTCAGAGGG - Intergenic
1176794694 21:13362615-13362637 CACTCTGGTGCATTTTAAGCAGG + Intergenic
1182431357 22:30300783-30300805 CAGCCTGGGGCATAGGCAGCTGG + Intronic
1203296285 22_KI270736v1_random:45752-45774 TATACTGGTGATTAGTCAGCGGG - Intergenic
956200610 3:66701756-66701778 TATTCTGCTGCCTAGTCATCTGG + Intergenic
957229306 3:77491142-77491164 CAAGCTGGTGAATAGTGAGCAGG - Intronic
958669338 3:97182275-97182297 CATTCTGATGGAATGTCAGCAGG - Intronic
958790091 3:98642471-98642493 CATTCAGGCACATAGTCATCAGG - Intergenic
962710310 3:138080695-138080717 CTTTCTGGCTCATACTCAGCTGG - Intronic
964289539 3:155162159-155162181 CATGCTGGTGCATCCTCAGTAGG + Intronic
967962646 3:194938356-194938378 CTTTCTGTTGAATAGCCAGCAGG + Intergenic
969389547 4:6880826-6880848 GATTCTGGAGCAAAGTCAGATGG + Exonic
974888004 4:67844024-67844046 CATTCAGATTCATAGTCAACTGG + Intronic
976971705 4:91111165-91111187 CATTATGGGGCAAACTCAGCTGG + Intronic
991349111 5:65702326-65702348 CATCATGGTGTATATTCAGCAGG - Intronic
991411300 5:66348045-66348067 CATTCTATTGCACTGTCAGCTGG - Intergenic
998584426 5:143412066-143412088 CCTTCTGGTGAAGAGTAAGCAGG + Intronic
1001345754 5:170896909-170896931 CATTCTGGTGCATAGTCAGCTGG - Intronic
1011261808 6:85477540-85477562 CAGGCTGGTGCATAGTCTGATGG + Intronic
1014014405 6:116513574-116513596 CATTCTGATGAAGAATCAGCAGG - Intronic
1015855356 6:137618387-137618409 AATTCTGGTGCCCAGTCACCTGG - Intergenic
1017005070 6:150023861-150023883 CATTCTGGTGCCTTGTCATGGGG - Intronic
1018569916 6:165198361-165198383 CATTCTGTGCTATAGTCAGCTGG - Intergenic
1021920145 7:25476554-25476576 CCTTTGGGTGCATAGTCAGCTGG - Intergenic
1021939835 7:25668586-25668608 CTTTTTGGTTCATAGTCATCTGG + Intergenic
1023899204 7:44461994-44462016 GATTCAGGTGCATAGGCAGGTGG + Intronic
1028964638 7:96788493-96788515 CATTTTGCTGCAGACTCAGCAGG - Intergenic
1030439617 7:109571548-109571570 AATTCTGTTTCACAGTCAGCAGG + Intergenic
1030619245 7:111771355-111771377 CATTGTGGTCCAGAGGCAGCTGG + Intronic
1033552671 7:142462170-142462192 AATTCTGGTGCAGTGTCAGGGGG + Intergenic
1034826549 7:154270491-154270513 CATTCTGGTACTTGGTGAGCTGG - Intronic
1038441133 8:27571605-27571627 CATTCTGCTGCATAGCCAGGAGG - Intergenic
1038533786 8:28339411-28339433 CATTCTGGTGCAGGGTGCGCCGG - Exonic
1048390540 8:133959430-133959452 CATTCTGGTGCATTGGGAGGAGG - Intergenic
1048463097 8:134639175-134639197 CAGTCTGGGGCAGAGTCTGCAGG + Intronic
1049438371 8:142598073-142598095 CACTCTGGAGCAGGGTCAGCTGG - Intergenic
1053887538 9:42655574-42655596 CACTCTGGTGCATTTTAAGCAGG - Intergenic
1054226560 9:62463024-62463046 CACTCTGGTGCATTTTAAGCAGG - Intergenic
1055421851 9:76151482-76151504 CAGTCGGGTGAATGGTCAGCAGG - Intronic
1057032339 9:91785439-91785461 CATTCTGATGCAAAGACAGATGG - Intronic
1058288195 9:103206104-103206126 CATTCTGCTGCCTGGACAGCAGG - Intergenic
1190252598 X:48738328-48738350 CATTCTGTTTCACAGCCAGCTGG - Intergenic
1195067444 X:101250496-101250518 CATTCAGGTGCCCCGTCAGCTGG + Exonic
1197091103 X:122538761-122538783 CTTTCTGGTGCAGAGGAAGCAGG - Intergenic