ID: 1001345758

View in Genome Browser
Species Human (GRCh38)
Location 5:170896931-170896953
Sequence GACCCAGTTGGTGGTCATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001345752_1001345758 1 Left 1001345752 5:170896907-170896929 CCCCAGCTGACTATGCACCAGAA 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1001345751_1001345758 2 Left 1001345751 5:170896906-170896928 CCCCCAGCTGACTATGCACCAGA 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1001345754_1001345758 -1 Left 1001345754 5:170896909-170896931 CCAGCTGACTATGCACCAGAATG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1001345753_1001345758 0 Left 1001345753 5:170896908-170896930 CCCAGCTGACTATGCACCAGAAT 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1001345750_1001345758 21 Left 1001345750 5:170896887-170896909 CCGGCGCGGCTCACAAGCGCCCC 0: 1
1: 0
2: 1
3: 2
4: 83
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001345758 Original CRISPR GACCCAGTTGGTGGTCATAC TGG Intronic
902041662 1:13496951-13496973 GACCCAGAGGGAGGTCATCCTGG + Intronic
902660478 1:17897342-17897364 TAGCCAGTTGGTGGTGATGCTGG + Intergenic
903386073 1:22927680-22927702 GACCTAGTTGGTGGTTGCACAGG + Intergenic
903862975 1:26376292-26376314 TCCCCTGTTGGTGGACATACGGG + Intergenic
905706109 1:40059903-40059925 CAACCAGTTAGTGGTGATACTGG + Intronic
908568721 1:65386313-65386335 GTGCCAGTGGGTGGTCATAGGGG + Intronic
910621916 1:89264820-89264842 GGCCCATTTGCTGGTCATAGTGG + Exonic
915014660 1:152721478-152721500 GACCCAGTTGGTGGTACAAGAGG - Intergenic
1065093744 10:22261283-22261305 GATCCAGGTGCTGGTTATACAGG - Intergenic
1073893264 10:108124205-108124227 GACCAAGTTGGGGGTCATAGAGG + Intergenic
1074483593 10:113852035-113852057 GCCCCAGTTGGTGGTTATTATGG - Intronic
1075232933 10:120699539-120699561 GAGCCAGTGGGTGGTCTCACTGG - Intergenic
1079585724 11:22124891-22124913 AAACCACTTGGTAGTCATACAGG - Intergenic
1080569492 11:33543034-33543056 GTCCCAGTTGATGGTGATGCGGG - Exonic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1093184361 12:16002991-16003013 CACCCAGTTTGTGGTGATAAGGG - Intronic
1094462564 12:30712935-30712957 CACCCTGTTGGTGGTCAGGCTGG + Intronic
1097566570 12:61277430-61277452 GACCATGTTGATGGTAATACTGG - Intergenic
1101231663 12:102747726-102747748 GACCCAGTGGGAGATCATAGGGG - Intergenic
1102473449 12:113173569-113173591 GACCCAGGCGGGGGTCACACAGG + Intronic
1117992159 14:61444695-61444717 CACCCAGTTGGTGATGAGACTGG - Intronic
1124874572 15:33579905-33579927 GACCCAGTGGGTGTTCATCAGGG + Intronic
1127744427 15:61951994-61952016 GAAATAGTTGGTGGTAATACTGG - Intronic
1146688703 17:34858260-34858282 GCCCAAGCAGGTGGTCATACAGG - Intergenic
1155218761 18:23665882-23665904 GTCCCAGTTGATGGTCCAACAGG + Intergenic
1155307584 18:24493733-24493755 AACCTGGTTGGTGGTCATATAGG - Intergenic
1157330416 18:46700022-46700044 CACCCAGATGGGGGTCATGCTGG - Intronic
1159393091 18:67820469-67820491 GACCCAGTTGCTGCTCCTTCGGG + Intergenic
1162535588 19:11261706-11261728 GAACCAGCTGGTGGGCAGACGGG - Intronic
932711612 2:74069513-74069535 GATCCAGGTGGTGGTCACACAGG - Intronic
945884035 2:215355739-215355761 GACCTGGTTGGTGGTGACACAGG - Intergenic
1172439949 20:34958284-34958306 GACCCAGTTTGTGGTAGGACTGG + Intergenic
1177020849 21:15855743-15855765 GGCCTAGTTGGTGGTCACATGGG - Intronic
1177207173 21:18023374-18023396 GTTCCAGCTGGTAGTCATACAGG + Intronic
1177984867 21:27961915-27961937 AACCCAGTAGGTGGTAACACAGG + Intergenic
1183817029 22:40310885-40310907 GACACACTGGGTGGCCATACGGG + Exonic
1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
963202845 3:142602257-142602279 GAGTGAGTTGGTGGTCATCCAGG + Intronic
966305590 3:178530375-178530397 GACCCAAATCGTGGTCGTACTGG + Intronic
970260627 4:14220692-14220714 GACCTAGTTGGGGGTCAAAGAGG + Intergenic
981822538 4:148902561-148902583 GAACCAGTTGCTGGGCATGCTGG + Intergenic
984523819 4:180832289-180832311 GGCCCACTAGGTGGCCATACAGG - Intergenic
985847633 5:2364168-2364190 GACCCAGTCAGTGGTCTCACAGG - Intergenic
990744346 5:58943455-58943477 GATCCAGATGGTGATCCTACTGG + Intergenic
996788955 5:127271600-127271622 GACCCAGTGGGTGGTCATGGGGG + Intergenic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1004693193 6:18010499-18010521 CACCAAGTTCGTGGTCTTACTGG + Intergenic
1006401759 6:33821794-33821816 TAGCCAGTTAGTGGTCCTACAGG - Intergenic
1013570846 6:111424018-111424040 TACCCAATTGTTGCTCATACTGG - Intronic
1013641509 6:112087410-112087432 GACCCAGTCGGTGGTCGTACAGG - Exonic
1026512184 7:71036758-71036780 GACCTCGGTGGTGGTCACACAGG - Intergenic
1036599097 8:10242491-10242513 GACCCAGGTGGTGGTTGTAAGGG + Intronic
1045325390 8:101114015-101114037 GACCCACTTCAGGGTCATACAGG - Intergenic
1046227984 8:111311210-111311232 GAGCAAGTTGGTGGTGGTACAGG - Intergenic
1051262603 9:15279487-15279509 GAGCCAGTGGGTGGTGAAACTGG - Intronic
1052755609 9:32537794-32537816 GCCCCTGTTGGTGGGAATACTGG + Intergenic
1052845743 9:33334792-33334814 GACCCTTTTGGTGGTCATTTAGG + Intronic
1057009897 9:91591514-91591536 GACCCAGGTGGTGCTCACAGGGG - Intronic
1057186828 9:93061807-93061829 GACCCAGATTGAGGTCACACAGG + Intronic
1187976988 X:24712759-24712781 GATCCATTTGGTGTTTATACTGG + Intronic
1191683729 X:63867705-63867727 GACTCAGTTGGTGGCCATTTAGG - Intergenic
1196841672 X:119865007-119865029 GACCCGGGTGGTGGTTATGCAGG + Intergenic