ID: 1001345758

View in Genome Browser
Species Human (GRCh38)
Location 5:170896931-170896953
Sequence GACCCAGTTGGTGGTCATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001345751_1001345758 2 Left 1001345751 5:170896906-170896928 CCCCCAGCTGACTATGCACCAGA No data
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1001345754_1001345758 -1 Left 1001345754 5:170896909-170896931 CCAGCTGACTATGCACCAGAATG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1001345750_1001345758 21 Left 1001345750 5:170896887-170896909 CCGGCGCGGCTCACAAGCGCCCC 0: 1
1: 0
2: 1
3: 2
4: 83
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1001345753_1001345758 0 Left 1001345753 5:170896908-170896930 CCCAGCTGACTATGCACCAGAAT 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1001345752_1001345758 1 Left 1001345752 5:170896907-170896929 CCCCAGCTGACTATGCACCAGAA 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001345758 Original CRISPR GACCCAGTTGGTGGTCATAC TGG Intronic