ID: 1001347082

View in Genome Browser
Species Human (GRCh38)
Location 5:170913342-170913364
Sequence GGGTGGGTGAATGCAAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001347073_1001347082 7 Left 1001347073 5:170913312-170913334 CCAGTTCAAGTTGAAGGCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG 0: 1
1: 0
2: 3
3: 41
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001347082 Original CRISPR GGGTGGGTGAATGCAAATGA TGG Intronic
900675500 1:3882919-3882941 TGGTGGGTGACTGTAAGTGATGG + Intronic
901169404 1:7245871-7245893 AGGAGGAGGAATGCAAATGAAGG + Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
903889807 1:26561794-26561816 GGGTGGATGCGTGCAAAGGAAGG + Intronic
904055113 1:27664945-27664967 GGGTGGGTGAAAGGAGATGGGGG + Intergenic
905291549 1:36925132-36925154 GGGTGGGTGAATGTATGTCAGGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
905865763 1:41375735-41375757 GGGTGGGGGACAGCAAATGAGGG + Intronic
905871658 1:41407876-41407898 GGGTGGGTGAGTGTAGAGGAGGG + Intergenic
907026419 1:51124635-51124657 GAGTGGATCAATGCAAATGGAGG + Intronic
907325058 1:53632350-53632372 GGGTGTGTGAATGGGACTGAGGG + Intronic
907419501 1:54337330-54337352 GGGTGGGTTATTGCAAAGCAAGG - Intronic
907639414 1:56171085-56171107 TGGTGGGTGATTGCTAGTGATGG - Intergenic
911431958 1:97800993-97801015 GGATGGATGAATGCAAAGAAAGG - Intronic
911447040 1:98009320-98009342 GGGTGGGTGAATGTCATTCAAGG + Intergenic
913452413 1:119001198-119001220 GGGTCGATGACTTCAAATGACGG - Intergenic
914680571 1:149935752-149935774 GGGTGGGTGTATCCAAGTGTGGG - Intronic
915608113 1:156967746-156967768 GAGTGGGTGAATGCATCTGTAGG - Intronic
916712727 1:167425963-167425985 GGTGGGGGGATTGCAAATGAAGG + Exonic
920941535 1:210487923-210487945 GGGATGGTGAAGGCAAATTATGG - Intronic
922445850 1:225696601-225696623 GGGTGGGAGAGTGGAAATAAAGG + Intergenic
922795185 1:228336280-228336302 GGGTGGGTGCATGCTTGTGAGGG + Intronic
923597021 1:235368258-235368280 TTGTGGGTGGATCCAAATGATGG + Intronic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
1063179062 10:3580620-3580642 GCGTGTGTGCATGCAAACGAGGG - Intergenic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1065869989 10:29947911-29947933 GGGTGGCTCAATGCAACTGATGG + Intergenic
1066446042 10:35484629-35484651 GGGTGGGATAATACAAAGGAAGG + Intronic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1068076345 10:52260107-52260129 GGCTGGGGGAATGGGAATGAGGG - Intronic
1068233389 10:54200522-54200544 GGGAGGGTGAATACAGATGAAGG - Intronic
1068266069 10:54651584-54651606 GGGTAGGTGAAAGCAAGGGAAGG + Intronic
1069866496 10:71506928-71506950 GGGTGGGTGACAGCAGCTGATGG + Intronic
1071069205 10:81671604-81671626 GGGTTGATGAATGCAAAGCATGG + Intergenic
1071231907 10:83597738-83597760 GAGTGGGTGTATGTAAAAGAGGG - Intergenic
1071515270 10:86292778-86292800 GGGTGTGTGTATGCAAGTGTGGG + Intronic
1076480911 10:130784767-130784789 TGGTGGGTGATTGCAGATGAGGG + Intergenic
1076805519 10:132856577-132856599 GGTGGGGTGAATGACAATGATGG - Intronic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1080313322 11:30920179-30920201 GGGCATGGGAATGCAAATGAGGG + Intronic
1080415973 11:32070384-32070406 GGTGGGGTGAATGCAAAAGGAGG - Intronic
1080898484 11:36465864-36465886 GGGTGGATGAATGAATATGATGG - Intergenic
1082663219 11:55941141-55941163 GGGTGTGCGAATGAAAATAAAGG - Intergenic
1083719257 11:64596109-64596131 GGATGGATGAATGGAATTGATGG + Intronic
1084451514 11:69241583-69241605 GGATGGGCCCATGCAAATGAAGG - Intergenic
1086013038 11:82128717-82128739 GTGTTGGTGATTGCAACTGATGG - Intergenic
1086851930 11:91819876-91819898 GGGTGGGTGGAGAGAAATGAGGG - Intergenic
1088997641 11:115015712-115015734 GGGTGGCTGAAAGCAAAGAAAGG + Intergenic
1089243293 11:117099129-117099151 GGGTGGGTGACAGCCAAAGAAGG + Intergenic
1090012268 11:123055732-123055754 AGGTGGGAGAATGCAAAGGTGGG + Intergenic
1090545525 11:127762573-127762595 GGGTGGTTCACTGGAAATGAAGG - Intergenic
1090628262 11:128624537-128624559 GGGTGGGGGGATGCCAATGCAGG + Intergenic
1091131173 11:133148414-133148436 GCGTTGGTAAATGGAAATGATGG + Intronic
1092998847 12:13976965-13976987 GACTGGGTGAATGTACATGAAGG + Intronic
1093793032 12:23277667-23277689 TGGTGAGTGAATGAATATGAAGG - Intergenic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096732441 12:53625644-53625666 GGGTGGATTATTGGAAATGAGGG - Intronic
1097079712 12:56421150-56421172 GGTTGGGGGAATGAAAATGAAGG + Intronic
1102199024 12:111044725-111044747 GGGTGGCTGAATCCACAGGAGGG + Intronic
1102829317 12:115981879-115981901 TGGTGGTTGAATGTAAAAGACGG + Intronic
1103012947 12:117471381-117471403 GGGTGGGTGTGTGCTAATAATGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106202690 13:27554394-27554416 GGGTTGGGGAAGGGAAATGATGG - Intronic
1106417377 13:29557656-29557678 GGGGGAGTGAATGTGAATGAGGG + Intronic
1106417442 13:29557972-29557994 GGGGGAGTGAATGTGAATGAGGG + Intronic
1106417446 13:29557992-29558014 GGGGGAGTGAATGCGAATGAGGG + Intronic
1106417525 13:29558352-29558374 GGGGGAGTGAATGTGAATGAGGG + Intronic
1106417577 13:29558613-29558635 GGGGGAGTGAATGTGAATGAGGG + Intronic
1107021883 13:35760506-35760528 GTGTGGCTGAAACCAAATGAAGG + Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112146392 13:96705142-96705164 GGGAGCCTGAATGTAAATGATGG - Intronic
1112391315 13:98986916-98986938 AGGAGGGTGAATGCTAAGGAAGG + Intronic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1113963984 13:114141769-114141791 GGGTGTGTGTGTGCGAATGAAGG - Intergenic
1115113959 14:29857286-29857308 AGCTGGGTGGTTGCAAATGAGGG - Intronic
1116873128 14:50086459-50086481 GGGTGGGTGAAGGAGAACGATGG - Intronic
1117226061 14:53660337-53660359 GGGTGTGTCTATGCAAATGTGGG - Intergenic
1119520422 14:75280492-75280514 GGGTGGGTGAATGGAGGTGATGG + Intronic
1119607720 14:76035101-76035123 GAGAGGGTGATTGAAAATGACGG - Intronic
1120749052 14:88180772-88180794 GGGTTGGTGAAGTCCAATGAAGG + Intronic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1122122683 14:99562850-99562872 GGGTGTGTGTGTGCATATGAGGG - Intronic
1123180918 14:106469323-106469345 GGGTAGCTGAATGCATGTGAGGG - Intergenic
1202945978 14_KI270726v1_random:27335-27357 GGGTAGCTGAATGCATGTGAGGG + Intergenic
1124385948 15:29208132-29208154 GGGAGGGTGAAAGCAAAAGAGGG - Intronic
1124795599 15:32775297-32775319 GGGTGGGTGGGTGGAAATCAGGG - Intronic
1126086401 15:45014504-45014526 GGGTAGGGAAATGCAGATGAAGG - Intergenic
1128155375 15:65388627-65388649 GGGTGGGTGGATGCAGAGGTGGG + Intronic
1128528429 15:68428268-68428290 GGGAGGGAGAATGCAAGGGAAGG + Intronic
1130106126 15:80929829-80929851 GGCTGGGGGAGTTCAAATGAAGG + Intronic
1130453783 15:84083253-84083275 GGGTTGGAGTAAGCAAATGAGGG - Intergenic
1131007312 15:88988372-88988394 GGGTGGGGGAAGGGAAAGGAGGG - Intergenic
1133021379 16:2968445-2968467 GCGTGTGTCCATGCAAATGAAGG + Intronic
1133614026 16:7459047-7459069 GGATGGATGAATGCAATAGATGG + Intronic
1134224587 16:12380957-12380979 TGGTGGGTGGATGAAATTGATGG - Intronic
1135933166 16:26756832-26756854 GGGTGGGTGGATGGATATGTGGG + Intergenic
1135976036 16:27109510-27109532 GGGTGGGTGAAAGGATACGAGGG + Intergenic
1136359952 16:29772636-29772658 GGGTGGCTGGAGGGAAATGAGGG - Intergenic
1137761945 16:50948197-50948219 GGGTGAGTGCATGTAAGTGATGG - Intergenic
1140691078 16:77484444-77484466 GGGTGGGGGCATGCAAATACTGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142335060 16:89483128-89483150 GGATGAGTGAAGGCAAATGGAGG - Intronic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1145004529 17:19329935-19329957 AGGAGGGTGAATGGAAATGCTGG - Intronic
1150442308 17:65201419-65201441 TGGTGAGGGACTGCAAATGATGG + Intronic
1154101995 18:11484535-11484557 GGGGGGGGGAATGCAGTTGAAGG + Intergenic
1154190198 18:12224310-12224332 GTGTAGGTGAATGCAGACGAGGG - Intergenic
1154512157 18:15118098-15118120 GCTGGGGTGAAGGCAAATGAAGG - Intergenic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1155913049 18:31527032-31527054 GAGTGAGTGAATGGATATGAAGG - Intronic
1157076300 18:44471385-44471407 AGGTGGGTTAGTGCAATTGAGGG - Intergenic
1157989872 18:52482081-52482103 GGGTGGGTGAGTGGATATGGCGG - Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159201021 18:65184179-65184201 AGGTGGATGAATGTAAATGAAGG + Intergenic
1161695186 19:5762975-5762997 GGGTGGGTGGATGGAATGGATGG + Intronic
1161766105 19:6209847-6209869 GGGTGGATGGATGGAAAGGATGG - Intergenic
1161837296 19:6656545-6656567 GGGTGAGGGACTGCAAATGAAGG + Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1162194478 19:8973766-8973788 GGGTGGGTGATTGTAAAGGGTGG + Exonic
1162872297 19:13595451-13595473 GGGTGGGTGGATGGATATGTGGG + Intronic
1162947964 19:14054982-14055004 GGGTGGGTGAGGCCAAAGGAGGG - Exonic
1163605698 19:18274227-18274249 TTCTGGGTGACTGCAAATGATGG - Intronic
1164685587 19:30164502-30164524 TCATGGGTGAAGGCAAATGATGG - Intergenic
1165181040 19:33969763-33969785 GTGTGTGTCAATTCAAATGAAGG - Intergenic
1166513337 19:43426206-43426228 GTGTGGATTAATGCAAATTAAGG - Intergenic
1167601250 19:50456120-50456142 GGATGGATGGATGGAAATGATGG - Intronic
925085545 2:1105008-1105030 CAGTGGGTGGATGGAAATGAAGG - Intronic
925134078 2:1514497-1514519 GGCTGGGTGAAGGCCAACGAGGG - Intronic
928856995 2:35814224-35814246 GGGTTGGTGCATGGAAATAAGGG - Intergenic
929123625 2:38503370-38503392 GTGTTGGTGACTCCAAATGAAGG - Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931835427 2:66093978-66094000 GGATGGGGGAATATAAATGAGGG + Intergenic
931909970 2:66888715-66888737 GGCTGGGTGGAGGCAAAGGAAGG + Intergenic
931992705 2:67807197-67807219 GGGTCAGTGAATGTACATGATGG - Intergenic
932402376 2:71489788-71489810 GGGTGGTGGAATGAGAATGAGGG + Intronic
932872228 2:75413302-75413324 GGGTGGGGGAAGGAAAAGGAGGG + Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
933739846 2:85524888-85524910 GGGTGGCTGAATGCAGAAAAAGG - Intergenic
935120316 2:100178395-100178417 GGGTGGGCCAATGCAAATCAAGG - Intergenic
935659696 2:105455574-105455596 GGGTAGGAGAATGCAAGTGGAGG - Intergenic
937446959 2:121966462-121966484 GGGTGGGTGAATGGGGATGATGG + Intergenic
938511721 2:131954865-131954887 GCTGGGGTGAAGGCAAATGAAGG - Intergenic
940117236 2:150222441-150222463 GGGAGGCTGACTGCAAATGTGGG - Intergenic
940611895 2:156003783-156003805 GGGTGGGTGAGTGTTAAGGAAGG - Intergenic
941006956 2:160257916-160257938 GGCAGGGTGAATCCAAATCATGG - Intronic
943754521 2:191544124-191544146 GGGTGGGTGGATGCGACTGAGGG - Intergenic
944407851 2:199405540-199405562 TGGAGGGCAAATGCAAATGATGG + Intronic
944845970 2:203668123-203668145 TGGTGGGTGAGTGCAATGGATGG - Intergenic
945539758 2:211070253-211070275 GTGTGTTTGAATGCAAAGGAAGG + Intergenic
946538657 2:220659354-220659376 GTGTGGGTGAAAGGAAAGGAAGG - Intergenic
947204714 2:227649851-227649873 AGGTGGGTGAATGTAGATGGTGG + Intergenic
947856497 2:233327984-233328006 GGGTGGGAGAATGGGAAGGATGG - Intronic
948097255 2:235346107-235346129 GTGTGTGTGCATGCACATGATGG + Intergenic
948583008 2:239000690-239000712 GGGGAGGGGAATGCAAATCAGGG - Intergenic
1169215898 20:3794778-3794800 GGGTGGGCCAATGCATCTGAAGG - Intronic
1169262810 20:4149938-4149960 TGGTGGCCGAATGCAAATGTGGG - Intronic
1170697919 20:18676590-18676612 GGGTGGGTAGAGACAAATGAAGG - Intronic
1172193271 20:33075029-33075051 GGGTGGATGAATGAAAAGAAAGG - Intergenic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173733307 20:45343078-45343100 GGCTGGGTGACTGAAAAAGAGGG - Intronic
1177458538 21:21377831-21377853 GGGTGGGTGCATGGGAAGGAAGG - Intronic
1177674904 21:24284645-24284667 GGGTGGCCAAATGCAAGTGATGG - Intergenic
1177979754 21:27897064-27897086 GCTGGGGTGAAGGCAAATGAAGG + Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178167065 21:29991311-29991333 GGGTGGATGTATGGAAATAATGG + Intergenic
1179030978 21:37719138-37719160 GGGTGGGTGAGAGCAAAAGAGGG + Intronic
1180085989 21:45508129-45508151 GGGTGGGTGGATGGAAAGGTGGG + Intronic
1180703795 22:17796470-17796492 GGATGGGCAAATTCAAATGAGGG + Intronic
1180995823 22:19964732-19964754 GGTTGGGGGAATGCACAAGATGG - Intronic
1182048536 22:27295921-27295943 GGATGGGTGAAAGGAAAGGAGGG + Intergenic
1183077881 22:35438238-35438260 GGGTGGGTGGATGAATATGTGGG - Intergenic
949263974 3:2135659-2135681 GGGCTGGTCAATGCAGATGAAGG + Intronic
950470531 3:13182579-13182601 GGGTGGGTGAATGGAAACCTAGG + Intergenic
951902120 3:27667078-27667100 GGTTGGGGGAATACCAATGAGGG + Intergenic
952521377 3:34161497-34161519 TGGCAAGTGAATGCAAATGATGG + Intergenic
953173146 3:40525387-40525409 GGGTGGCTGAATGCGGATTAAGG - Intronic
953265761 3:41386271-41386293 GGGTGGGTGAATGTGAAAGCAGG - Intronic
954414394 3:50385954-50385976 GGGTGGGGGAAAGAAAAGGAAGG - Intronic
954462151 3:50633464-50633486 GCGTGGGTGAGTGCATATGTAGG - Intronic
955090624 3:55746887-55746909 GGGAGGGTGAAGGAAACTGATGG + Intronic
956495607 3:69822717-69822739 GGGTGGGTGAATTCAAAATGTGG - Intronic
959064401 3:101642133-101642155 AGGTGGGTGAATGCCAAGGTTGG - Intergenic
961233516 3:125342000-125342022 GGGGGGGGGAATGGAAATCATGG + Intronic
963836177 3:150060153-150060175 GGGAGGGTGAGTTCAAATCAGGG - Intergenic
968946142 4:3665508-3665530 GGGTGGGTGAATGGATAGGTGGG - Intergenic
971122158 4:23716691-23716713 ATATGGCTGAATGCAAATGAAGG - Intergenic
971245092 4:24920228-24920250 TCCTGGGTGAATGTAAATGATGG + Intronic
971935004 4:33136656-33136678 GGCTGGGAGAATGGGAATGATGG - Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
975499716 4:75071183-75071205 GGGTGGGGGAAGTGAAATGAAGG - Intergenic
978077449 4:104550536-104550558 GGGAGGGGGAATTTAAATGAAGG + Intergenic
978440627 4:108729921-108729943 GGGTGGGGCAATGCATATGGAGG + Intergenic
979193569 4:117892927-117892949 GAGTGAGTGGATGCAAATGCTGG + Intergenic
982184166 4:152779618-152779640 GGGTGTGTGAATGAAAAAGAGGG + Exonic
984095553 4:175428436-175428458 GGGTGGGTGAGGCCAAATAAGGG + Intergenic
984501668 4:180565929-180565951 GTTTGGGTGAATGCAGGTGAGGG + Intergenic
986125234 5:4878267-4878289 TTGAGGGTGAAAGCAAATGAAGG - Intergenic
986684743 5:10266863-10266885 GGTTGGTTGAATTCAGATGAGGG + Intergenic
987725926 5:21699550-21699572 GAGTGGGAGAGTGGAAATGAAGG - Intergenic
988936640 5:36090059-36090081 GGGTGGCCCAATGCAAATTAAGG + Intergenic
989453365 5:41612954-41612976 GGGTGGGTGAATGGATATGTGGG - Intergenic
992299406 5:75363199-75363221 AGGAGGCTGAATGCAAAAGATGG + Intergenic
994407151 5:99359436-99359458 GGGAGGGAGCATGCAAGTGAAGG + Intergenic
994674007 5:102798800-102798822 TGGTGGGTGAAGGGAAAAGAAGG + Intronic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
997847085 5:137296454-137296476 GGATGGGTGACTGCAAAGCATGG + Intronic
997877015 5:137558643-137558665 GGGTGGGTGAGAGCAAAAGGTGG + Intronic
999019398 5:148146886-148146908 GTGATGGTGAATGCCAATGATGG - Intergenic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1001569195 5:172719039-172719061 GGGTGGGTGGATGGACAGGATGG + Intergenic
1001569743 5:172722629-172722651 GGATGGGGGGATGCAAATGCTGG - Intergenic
1001828789 5:174767863-174767885 GGGTGGGTGGATGGATAAGAGGG - Intergenic
1002840154 6:898522-898544 GGGAGGGAGAAAGCAAAGGATGG - Intergenic
1003008036 6:2399589-2399611 GTGTGCCTGAATACAAATGATGG - Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1003949883 6:11107550-11107572 GAGTGGGAGAATGAAAAGGAAGG - Intronic
1005743951 6:28818772-28818794 GTGTGTGTGCATGTAAATGATGG + Intergenic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1007335844 6:41154383-41154405 GGGTGGGAGAAAGGAAATGATGG + Intergenic
1007462969 6:42031276-42031298 GGGTGGGTGAAGTCAGGTGAGGG - Intronic
1010366797 6:75060494-75060516 GGGTGTTTGAACCCAAATGATGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010949512 6:82018480-82018502 GGTTGGGTGCATTCAAGTGAAGG + Intergenic
1011184035 6:84654474-84654496 GGGTGGGTGGTTGGAGATGAAGG + Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1011626350 6:89286725-89286747 GGGTGGGTGGCTGCAGAGGAGGG + Intronic
1012023402 6:93956101-93956123 GGGTGGGTAAGTTCAAAGGAAGG - Intergenic
1012231182 6:96762623-96762645 GGGTAGCTGGATGCAAAGGAGGG - Intergenic
1012956485 6:105576393-105576415 GGGTGGGTGGAGGAAAATGAAGG - Intergenic
1015961471 6:138653910-138653932 GGGTTGGTGAAATCAAATTAGGG - Intronic
1016628568 6:146200709-146200731 GGGATGGTGAAAGCATATGAAGG + Intronic
1019183725 6:170208860-170208882 GGGTGAGTGCATGCAAGTGAGGG - Intergenic
1020768153 7:12352219-12352241 GGGTGGGTGAATTCAACTGAAGG - Intronic
1023473247 7:40548609-40548631 GGGTGGGGGAATGCTGATGACGG - Intronic
1023629616 7:42150928-42150950 GGGAGGGTGAGTGGAAATGAGGG + Intronic
1024245246 7:47464792-47464814 GGGAGACTGAGTGCAAATGATGG - Intronic
1024666154 7:51549091-51549113 TGGTGGGTGAAAGAACATGATGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026311416 7:69188057-69188079 GGGTGGGTCAATGCCAGGGAGGG + Intergenic
1026901523 7:74040023-74040045 GGGCAGGTGAGTGCAAAGGAAGG + Intronic
1026916171 7:74121422-74121444 GGGTGGGAGAAGGCAAGTCAGGG - Exonic
1027507149 7:79030617-79030639 GGGTGGATGAACACAAAAGAAGG + Intronic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG + Intronic
1031370718 7:120962071-120962093 GGTTGAGGGAATGCACATGATGG + Intronic
1032801812 7:135322841-135322863 GGGTGTGTTAATTCAAATGCAGG - Intergenic
1033610621 7:142960778-142960800 GGGTGGATGATTGGAGATGATGG - Intronic
1034336652 7:150328154-150328176 GGGTAGGTGAATGGAGAAGAAGG + Intronic
1034946431 7:155265338-155265360 GGGTGTGTGCATGCACATGTGGG - Intergenic
1035226132 7:157433445-157433467 GGGTGGGTGACTGCAGGTGCGGG - Intergenic
1035247000 7:157569114-157569136 GGCTGGGAGAATCCAAGTGAGGG + Intronic
1035648321 8:1245574-1245596 GGCTGGGGGCATGGAAATGAGGG + Intergenic
1035869612 8:3123203-3123225 CGATGGGGGAATGCAGATGAGGG - Intronic
1037008114 8:13806872-13806894 GGGAGGGAGAAAGCAAAGGAGGG - Intergenic
1037075622 8:14713523-14713545 GTGTTGCTAAATGCAAATGAGGG + Intronic
1038392780 8:27220088-27220110 GGGTGGGTGAAGGCATCTCAAGG - Intergenic
1038492923 8:27982878-27982900 GGGAGGGTGAAGAGAAATGAGGG + Intronic
1039922533 8:41903514-41903536 GGGTGGGAGAGTGCAGAGGAGGG - Intergenic
1040554529 8:48467475-48467497 GGGTGAGGGAATGCCAAAGAGGG + Intergenic
1045614411 8:103891791-103891813 GAGAGGGTGAATGGAAATGGTGG + Intronic
1046447365 8:114340448-114340470 GGTTGGGTAAAGGCAAATAAGGG + Intergenic
1046702355 8:117415540-117415562 GGGTGGGTGACTAAGAATGAAGG - Intergenic
1047016553 8:120729519-120729541 GTCTGGGTGAATGGAAGTGAGGG + Intronic
1048374303 8:133809271-133809293 GGGTGGCTGGATGCAGAAGATGG - Intergenic
1049348344 8:142150935-142150957 GGGTGGATGAATGAATATGTAGG + Intergenic
1049348367 8:142151075-142151097 GGGTGGATGAATGAATATGTAGG + Intergenic
1049598870 8:143498049-143498071 GGGTGAGCGAATGCAAGTGAAGG + Intronic
1050896575 9:10890544-10890566 GGGTAGGTGAAGGAAAAAGAGGG - Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1056429697 9:86514962-86514984 AGGTGGGTGCATGAGAATGAGGG - Intergenic
1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG + Intergenic
1056951490 9:91043765-91043787 AGGTGGGTGCATGCACATGAGGG - Intergenic
1058123769 9:101168268-101168290 GGGTTGTTGAATGCAAGTTAAGG - Intronic
1061107322 9:128541527-128541549 GGGTAGGTGGGTGCAAATGGTGG - Exonic
1061903262 9:133683808-133683830 GGGTGGGGAAATGCTAAGGAAGG - Intronic
1188139987 X:26537926-26537948 GGGTGGGTGAGTGCAGAGTATGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1196072888 X:111544974-111544996 GGGTAGGTGCATGGAAATAAGGG - Intergenic
1197859840 X:130958851-130958873 GTGTGGGTGAGTGGAAAGGAAGG - Intergenic
1200145145 X:153922468-153922490 GGGTGGGGGAATGCACAGGTGGG - Intronic
1200155078 X:153970891-153970913 GGGTGTGTGAAAGGAATTGAGGG - Exonic