ID: 1001349738

View in Genome Browser
Species Human (GRCh38)
Location 5:170948842-170948864
Sequence ATGTCTGTCTACCTGTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001349738_1001349745 24 Left 1001349738 5:170948842-170948864 CCAGCATACAGGTAGACAGACAT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1001349745 5:170948889-170948911 TGCCTGTAATCCCAGCAGTTTGG 0: 1368
1: 98913
2: 242362
3: 303850
4: 258834
1001349738_1001349748 28 Left 1001349738 5:170948842-170948864 CCAGCATACAGGTAGACAGACAT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1001349748 5:170948893-170948915 TGTAATCCCAGCAGTTTGGGAGG 0: 3819
1: 309289
2: 271603
3: 206826
4: 226724
1001349738_1001349746 25 Left 1001349738 5:170948842-170948864 CCAGCATACAGGTAGACAGACAT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1001349746 5:170948890-170948912 GCCTGTAATCCCAGCAGTTTGGG 0: 2757
1: 231714
2: 280934
3: 229260
4: 268565
1001349738_1001349743 -3 Left 1001349738 5:170948842-170948864 CCAGCATACAGGTAGACAGACAT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1001349743 5:170948862-170948884 CATATAGGACCTGGGTGCGGTGG 0: 1
1: 0
2: 0
3: 22
4: 338
1001349738_1001349742 -6 Left 1001349738 5:170948842-170948864 CCAGCATACAGGTAGACAGACAT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1001349742 5:170948859-170948881 AGACATATAGGACCTGGGTGCGG 0: 1
1: 0
2: 0
3: 12
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001349738 Original CRISPR ATGTCTGTCTACCTGTATGC TGG (reversed) Intronic
901416464 1:9120077-9120099 AGGTGTGTCTCCCTGTCTGCAGG - Intronic
901620195 1:10578843-10578865 ATTTCTGTTTACCTGTCTTCAGG - Intronic
903311829 1:22465023-22465045 TTGTCTGCATACCTGGATGCAGG - Intronic
905194269 1:36262590-36262612 ATGTCTGTATATCAGTATGGGGG + Intronic
908157956 1:61375702-61375724 ATGGCTTTCTGCCTGTCTGCTGG + Intronic
910269428 1:85377719-85377741 GTGTGTGTCTACTTGTATGGGGG - Intronic
913178847 1:116299706-116299728 ATGTCTGTCTCCCTGCCTCCAGG + Intergenic
913670826 1:121096043-121096065 ATGTCTGTCTTCTTGAAGGCTGG - Exonic
914022589 1:143883466-143883488 ATGTCTGTCTTCTTGAAGGCTGG - Intergenic
914661075 1:149791408-149791430 ATGTCTGTCTTCTTGAAGGCTGG - Exonic
918250037 1:182694946-182694968 ATTTCTGTGTACCTATATGTGGG - Intergenic
921487189 1:215729005-215729027 GTGTTTGTCTTCCTGTATCCAGG + Intronic
923789807 1:237102355-237102377 ATGTGTGTGTGCCTGCATGCAGG - Intronic
924591098 1:245405325-245405347 ATGTTTGCCTACCCGTGTGCAGG + Intronic
1062858527 10:792000-792022 ATGTATGTGTGCCTGTGTGCAGG + Intergenic
1063624540 10:7676804-7676826 ATGTCTGTCTGCCTCTGTGCTGG + Intergenic
1065471895 10:26090865-26090887 ATGGCTGCCTTCCTGTCTGCAGG + Intronic
1069580585 10:69563407-69563429 ATGTCTGTCTGCCTGTCTCTGGG + Intergenic
1069718061 10:70533389-70533411 GTGTGTGTGTACCTGTATGTAGG + Intronic
1070268687 10:74930510-74930532 AAATCTTTCCACCTGTATGCAGG + Intronic
1071436868 10:85655433-85655455 ATGTCTGTCAGACTGTATGTGGG - Intronic
1073879691 10:107966462-107966484 ATGACTGTCTAGCTGTCTTCTGG - Intergenic
1074269411 10:111938369-111938391 ATGCCTATCTACCTGTATGTAGG - Intergenic
1074500692 10:114021341-114021363 ATGTCTGTCTATCTGCCTGCTGG + Intergenic
1075934573 10:126328515-126328537 ACGTGTGTGTACCTGTTTGCAGG - Intronic
1076751215 10:132544330-132544352 CTGTCTTCCTACCTGTGTGCCGG + Intronic
1082681699 11:56180881-56180903 AGGTCTGTCCAGCTGTATGTGGG + Intergenic
1084076870 11:66785742-66785764 CTGCCTGTCTACCTGAATGTTGG - Intronic
1085019147 11:73194253-73194275 GTGACTTTCTCCCTGTATGCAGG + Intergenic
1085371659 11:76012905-76012927 GTGTCTGTATCCCTTTATGCAGG + Intronic
1087838697 11:102900456-102900478 ATGTATATGTTCCTGTATGCAGG - Intergenic
1088165622 11:106932899-106932921 ATAGCTGGCTAGCTGTATGCAGG + Intronic
1090166087 11:124549385-124549407 ATTTCTGTCAACATGTCTGCTGG - Intergenic
1090239884 11:125174606-125174628 AAGGCTGTCTACCTGTAGGCAGG + Intronic
1092394663 12:8115094-8115116 CTGTCTGTCTACCTGTGGCCTGG + Intergenic
1096171944 12:49478839-49478861 ATGTCATTCTTCCTGGATGCAGG - Intronic
1097175448 12:57139869-57139891 CTGTGTGTCTTTCTGTATGCTGG - Intronic
1099816154 12:87650908-87650930 ATGTATGCCTACATGTATGATGG - Intergenic
1102179117 12:110898644-110898666 ATGTGTGTCTACATGTCTACAGG - Intronic
1103965966 12:124639524-124639546 ATGTCTGCCTAGGTGTAGGCAGG - Intergenic
1106572087 13:30935809-30935831 TTGTCTGTGTACCTCAATGCGGG + Intronic
1106610942 13:31279970-31279992 AAGTCTGTCTGCCTGTAGGCTGG - Intronic
1111295362 13:86270011-86270033 ATGTCTGTGTAGTTGTGTGCAGG + Intergenic
1111509748 13:89245317-89245339 ATGTATCTGTACTTGTATGCTGG - Intergenic
1114897951 14:27015893-27015915 TTGTGTGTCTGCCTGTTTGCTGG - Intergenic
1114965395 14:27953436-27953458 ATGTCTGTTCAGTTGTATGCAGG - Intergenic
1115332108 14:32208947-32208969 ATGTTTTTCTAAGTGTATGCAGG + Intergenic
1117926814 14:60789592-60789614 AAGTCTGTCTAACTTTATGAAGG - Intronic
1119543579 14:75456374-75456396 CTGTCTGTCTGCCTGTTTGTCGG + Intronic
1120737376 14:88068037-88068059 ATCTATGTCTACCTATATCCAGG + Intergenic
1124365738 15:29070331-29070353 ATGTCTGGATACCGGGATGCAGG + Intronic
1124465924 15:29939817-29939839 ATGTCTGTCTACCAGGAAGTGGG + Intronic
1126660152 15:51025297-51025319 GTGTCTGTCTCCATGTATGCTGG - Intergenic
1126931190 15:53653414-53653436 ATGTCAGTTTACCATTATGCAGG - Intronic
1127403282 15:58613351-58613373 ATGTCTGTGTGCCTGTCTGGTGG - Intronic
1129056673 15:72825111-72825133 ATGTGTGTCTGTGTGTATGCTGG + Intergenic
1131709014 15:95032794-95032816 ACGTCTGTCTGCCTCTAAGCTGG + Intergenic
1132722170 16:1321795-1321817 ATGTGTTTCTCCCTGGATGCGGG + Intronic
1134760019 16:16705993-16706015 ATGTCTGTCTAACTTTACGCAGG - Intergenic
1134986052 16:18653212-18653234 ATGTCTGTCTAACTTTACGCAGG + Intergenic
1136030978 16:27502824-27502846 CTGTCTGTCTGTCTGTCTGCTGG - Intronic
1141426963 16:83950286-83950308 ATGTGTGTGTACGTGTGTGCTGG - Intronic
1149935669 17:60804141-60804163 ATGTATGTATACATATATGCAGG + Intronic
1150272244 17:63873963-63873985 ATGTTGGTCAACCTGAATGCGGG + Intronic
1150284028 17:63945529-63945551 ATGGGTGTCAACCTGTTTGCCGG - Exonic
1155102797 18:22629498-22629520 CTGTCTGTCTGGCTGGATGCAGG - Intergenic
1156039509 18:32804631-32804653 ATGCCTGTCTCCCTGGATTCTGG - Intergenic
1160574456 18:79843489-79843511 TTGTCTTTCTACTTTTATGCTGG - Intergenic
1161633600 19:5373050-5373072 ATGTATGCCTACCTGCATGTAGG + Intergenic
1165961189 19:39535781-39535803 AAGTCTGTCTGCATGTGTGCAGG + Intergenic
925268475 2:2583973-2583995 AAGTCTGTCAACCAATATGCTGG - Intergenic
929306505 2:40368969-40368991 ATAACTGGCTAGCTGTATGCAGG + Intronic
930496531 2:52152006-52152028 ATGTATGTCTGCTTTTATGCCGG - Intergenic
935058724 2:99590159-99590181 ATGTCTTACTACCTGGATGAGGG + Intronic
935803564 2:106724624-106724646 ATGTGCGTCTATGTGTATGCAGG + Intergenic
937520658 2:122709520-122709542 ATGTCTGTCCATCTGTCTACTGG - Intergenic
938409503 2:131052452-131052474 GTGTCTGTCTTCCTTTCTGCAGG - Exonic
938950799 2:136252640-136252662 AAATCTGTATACCTGTATGATGG - Intergenic
940129339 2:150363299-150363321 ATGGCTTTCTCCCTGTATGTGGG - Intergenic
940951528 2:159680853-159680875 ATTTTTGTCTTCCTGTCTGCTGG - Intergenic
944587627 2:201186460-201186482 TAGTCTGTCTACCTGTTTCCCGG + Intronic
947879325 2:233491632-233491654 GTGTCTGTCTGTCTGTGTGCAGG + Intronic
1169498778 20:6139289-6139311 ATGTTTGTCTACATGTAGACAGG - Intergenic
1175578887 20:60083740-60083762 AGGTCTGTTTCCCTATATGCAGG + Intergenic
1181026302 22:20129700-20129722 ATGTCTGTCTGCCGGGCTGCAGG + Intronic
1185136690 22:49077479-49077501 AAGTCTGTCTACATGTGGGCAGG - Intergenic
949341241 3:3033311-3033333 ATGTCTGGAAATCTGTATGCTGG - Intronic
954839334 3:53496419-53496441 TTGTCTGTCTCTCTGGATGCTGG + Intronic
955304109 3:57812438-57812460 ATATATGTCTGTCTGTATGCCGG + Intronic
956394192 3:68807310-68807332 ATGTCTGTCTATCTCTAGGGAGG + Intronic
957173686 3:76775204-76775226 ATTTCTGTTTTCCTGTATGTAGG - Intronic
958046600 3:88292181-88292203 TTGTTTGTCTATCTGTATGTGGG + Intergenic
958644112 3:96846996-96847018 CAGTCTGTCTTCCTGGATGCTGG + Intronic
966352491 3:179046058-179046080 TTCTCTGTCTAGCTGCATGCCGG - Intronic
970763272 4:19517037-19517059 ATTTCTGTGCACCTGCATGCAGG - Intergenic
971019598 4:22520421-22520443 ATGTCTGTCTGTCTGTAAGCTGG + Intergenic
972741217 4:41888130-41888152 TTGTCTGTCTACCAGAAGGCAGG + Intergenic
975243149 4:72086387-72086409 ATTTCTGTCTCACTGTAAGCAGG + Intronic
976419203 4:84819310-84819332 ATGACTGTTTGCCTGAATGCAGG - Intronic
980192992 4:129549016-129549038 ATCTCTGCCTATCTCTATGCCGG - Intergenic
983335203 4:166383113-166383135 ATCTCTGTCTACTTTTTTGCTGG - Intergenic
984878114 4:184387284-184387306 ATGTCTGTCTTCCTCTGTGTTGG - Intergenic
985647427 5:1091508-1091530 CTGTCTGTCCGCCTGTGTGCTGG - Intronic
990831023 5:59957317-59957339 ATGTCTGTCTAATTCTATACTGG - Intronic
995847119 5:116505428-116505450 GTGTCTGTGTACCTGTGTGTTGG - Intronic
997724497 5:136109280-136109302 TTGTCTGGCCACCTGAATGCAGG + Intergenic
998354370 5:141522463-141522485 ATGTCTGGCTACCTGTGGACAGG + Intronic
998445369 5:142194381-142194403 CAGTCTGTCTACCTGTCTCCTGG - Intergenic
998968599 5:147567230-147567252 ATGTGTGTGTATCTGTATACTGG + Intergenic
999811301 5:155130043-155130065 CTTTCTGTCTACCTGAATGATGG - Intergenic
1001349738 5:170948842-170948864 ATGTCTGTCTACCTGTATGCTGG - Intronic
1001459413 5:171896607-171896629 AGGTCTGTCTAGCTCTATCCAGG - Intronic
1002220349 5:177674708-177674730 GTGTCTGACTACCTGCTTGCTGG + Intergenic
1002819100 6:707129-707151 ATGGATGTGTACGTGTATGCAGG - Intergenic
1003802063 6:9681110-9681132 AAGTCTGGCTGCCTGTGTGCCGG - Intronic
1004229548 6:13818699-13818721 CTGTCTTTCCACCTGAATGCAGG + Intergenic
1007176198 6:39899314-39899336 ATGTCTCTCTGCCTGTTTCCTGG + Intronic
1009887044 6:69635920-69635942 ATTTCTGACTAACTGTATACAGG + Intergenic
1010341179 6:74755020-74755042 ATGTCATTCTTCCTGTATGCAGG + Intergenic
1012380785 6:98616716-98616738 AAGTCTGTCTGCCTGTGGGCTGG - Intergenic
1013286316 6:108685204-108685226 ATGTCTGACTTTCAGTATGCAGG - Intergenic
1015961729 6:138657123-138657145 ATGTCTGTTTACCCCAATGCAGG - Intronic
1019137376 6:169918934-169918956 ATGTGTGTATACATGTGTGCAGG + Intergenic
1019831265 7:3333492-3333514 ATCTCTGACTACTTGTATGTTGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028132731 7:87195617-87195639 AGGTCTCTATACTTGTATGCTGG - Exonic
1028330536 7:89585206-89585228 CTTTCTGTCTGCCTGTAGGCTGG - Intergenic
1028503076 7:91540636-91540658 ATGTCTGTCTCACTGTATTTTGG - Intergenic
1028979334 7:96949871-96949893 ATGTCTCTCTTTCAGTATGCAGG - Intergenic
1030726497 7:112932245-112932267 ATGTATGTCTCTCTGTATGTTGG - Intronic
1030867316 7:114715187-114715209 GTGTCTTTCTACCTGCATCCTGG - Intergenic
1033328898 7:140401899-140401921 ATGTCTTTTTAACTGTAGGCTGG - Intronic
1033828955 7:145228822-145228844 ATGTGTGTATACATGTATGTGGG - Intergenic
1036131857 8:6122812-6122834 ATATTTGTCTACATGTATGTGGG - Intergenic
1041802234 8:61812811-61812833 ATTTCTGCCTCCCTGTAAGCTGG - Intergenic
1044626727 8:94241387-94241409 GTGAGTGTCTACCTGCATGCTGG + Intergenic
1045954387 8:107889760-107889782 AAGTCTGGCTGCCTGTAGGCCGG - Intergenic
1046783374 8:118239765-118239787 ATCTCTGTCTCCCTTTATGTTGG - Intronic
1048445052 8:134487120-134487142 ATGTGTGTATACATGTACGCAGG + Intronic
1049202684 8:141349588-141349610 CTGTGTGTCTACATGTACGCAGG - Intergenic
1050952073 9:11610189-11610211 ATGTCTGTATATCTGTGTCCTGG + Intergenic
1052579226 9:30332408-30332430 ATTTCTGTTTACATGTTTGCTGG + Intergenic
1056460341 9:86803721-86803743 ATGTCTGTGTACCTATTTGTGGG + Intergenic
1056721466 9:89075798-89075820 ATGTCTATCTATCCTTATGCTGG - Intronic
1060104774 9:120866732-120866754 ATGTATGCCTACCTGTTTACTGG - Intronic
1062116665 9:134813244-134813266 ATGTGTGTGTGCCTGCATGCTGG + Intronic
1186531325 X:10298822-10298844 CTGCCTGTCAACCTGCATGCTGG - Intergenic
1186792301 X:13011083-13011105 ATGATTTTCTACCTGGATGCTGG - Intergenic
1187806156 X:23123177-23123199 AAGTCTGTCTCCCTGTATTGTGG + Intergenic
1193227303 X:78998708-78998730 ATGTCTGACTACCCCTATTCAGG - Intergenic
1196808332 X:119608133-119608155 ATGTCTGTCTTTCTCTATGGTGG - Intergenic
1197660508 X:129166127-129166149 CCTTCTGTATACCTGTATGCAGG - Intergenic