ID: 1001357422

View in Genome Browser
Species Human (GRCh38)
Location 5:171042368-171042390
Sequence TCAACTCCATGTAATCCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001357418_1001357422 5 Left 1001357418 5:171042340-171042362 CCTATCCTAACCATATGATAGGA 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1001357422 5:171042368-171042390 TCAACTCCATGTAATCCTAAGGG No data
1001357420_1001357422 -5 Left 1001357420 5:171042350-171042372 CCATATGATAGGAATTTTTCAAC 0: 1
1: 1
2: 2
3: 31
4: 341
Right 1001357422 5:171042368-171042390 TCAACTCCATGTAATCCTAAGGG No data
1001357419_1001357422 0 Left 1001357419 5:171042345-171042367 CCTAACCATATGATAGGAATTTT 0: 1
1: 0
2: 3
3: 27
4: 298
Right 1001357422 5:171042368-171042390 TCAACTCCATGTAATCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001357422 Original CRISPR TCAACTCCATGTAATCCTAA GGG Intronic
No off target data available for this crispr