ID: 1001360560

View in Genome Browser
Species Human (GRCh38)
Location 5:171081108-171081130
Sequence CTTTAAACTCAGATGGACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001360560_1001360566 19 Left 1001360560 5:171081108-171081130 CCCTAGTCCATCTGAGTTTAAAG 0: 1
1: 0
2: 1
3: 12
4: 151
Right 1001360566 5:171081150-171081172 CCAGCTGTGTCTCTGAGGACAGG 0: 1
1: 1
2: 4
3: 37
4: 309
1001360560_1001360564 14 Left 1001360560 5:171081108-171081130 CCCTAGTCCATCTGAGTTTAAAG 0: 1
1: 0
2: 1
3: 12
4: 151
Right 1001360564 5:171081145-171081167 ACTTTCCAGCTGTGTCTCTGAGG No data
1001360560_1001360567 30 Left 1001360560 5:171081108-171081130 CCCTAGTCCATCTGAGTTTAAAG 0: 1
1: 0
2: 1
3: 12
4: 151
Right 1001360567 5:171081161-171081183 TCTGAGGACAGGCACTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001360560 Original CRISPR CTTTAAACTCAGATGGACTA GGG (reversed) Intronic
902553665 1:17234081-17234103 CTTTGGAATCAGATGGACTTGGG + Intronic
902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG + Intergenic
903850427 1:26302521-26302543 CTGCAAACACAGATGGTCTACGG - Intronic
904969904 1:34411308-34411330 CTTTAAGCTCAGTTGTACAATGG - Intergenic
906002165 1:42435801-42435823 CTTTAGAATCAGATAGACCAGGG - Intronic
908321054 1:62979341-62979363 CTTTAAATTCAAATGTAGTATGG + Intergenic
908778885 1:67670104-67670126 CTTTCAAATCAGATGGATGAAGG + Intergenic
908807545 1:67946721-67946743 CTCTATACTCAGTTGGACTTGGG + Intergenic
909142389 1:71884815-71884837 CTTTAAATTCACATGGACAAAGG + Intronic
909765934 1:79355769-79355791 CCTTTCACTCAGATGGTCTAGGG + Intergenic
910595227 1:88973827-88973849 ATTGAAACTTTGATGGACTAGGG - Intronic
911749312 1:101478493-101478515 CTTTAGACTCAGATGCACACTGG - Intergenic
914412977 1:147449395-147449417 CTTTAGAGTCAGATGGACATGGG + Intergenic
915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG + Intergenic
916899801 1:169208941-169208963 ATCTAAAAACAGATGGACTATGG - Intronic
918338822 1:183549961-183549983 CTGTACACTCAGATTGATTAAGG + Intronic
922332754 1:224591756-224591778 CTTTAGAGTCAGATGGATTTGGG + Intronic
923198258 1:231688359-231688381 GTTTGAACTCAGAAGCACTAAGG - Intronic
923707332 1:236354813-236354835 CTTTAAACTGAGATGGAATTTGG - Intronic
1064907535 10:20362999-20363021 CTTTAAACTGATTTGGATTATGG - Intergenic
1071349456 10:84725035-84725057 TTTTAAAATCAGATTTACTAAGG + Intergenic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1073286462 10:102392518-102392540 CCTTAAATTAAAATGGACTAAGG - Intergenic
1073997056 10:109327563-109327585 CTTTAAAGTCAGATTGAATCAGG + Intergenic
1078315664 11:10291308-10291330 CTTTAACCTCATATGGCTTAAGG - Intronic
1078534584 11:12162866-12162888 CCCTAGAATCAGATGGACTAAGG - Intronic
1079160153 11:17984751-17984773 CTTTGAAGTCAGATAGACCAAGG - Intronic
1084475709 11:69387480-69387502 CTTTAACCTCAGATGGGCCTGGG + Intergenic
1093432518 12:19100029-19100051 TTTTAAAACAAGATGGACTATGG - Intergenic
1094447815 12:30551098-30551120 CTGTAAAATCACATGGACTTTGG - Intergenic
1097240430 12:57571461-57571483 TTTTAAAATCAGATGGAAGAAGG + Intronic
1097590979 12:61574677-61574699 CATTAAAATTAGATGGACTTCGG - Intergenic
1098121494 12:67245173-67245195 TTTTAAACTCAGTTGTTCTACGG - Intergenic
1099513301 12:83564960-83564982 CTTTTATCTCAGAAGGACTAAGG + Intergenic
1100553942 12:95673316-95673338 CTTTAAACTCTCTTGGACAAGGG - Intronic
1100722751 12:97376018-97376040 CTTTGAAATCAGATGGATTTGGG + Intergenic
1105358564 13:19684291-19684313 TTTTAAACCATGATGGACTACGG + Intronic
1105424029 13:20278690-20278712 ATATAAACTCAGATGCACTTGGG + Intergenic
1105561502 13:21496724-21496746 TTTTGAAGTCAGATGGACCAAGG - Intronic
1105797820 13:23873815-23873837 CTGTAAACTCACATTGCCTAAGG - Intronic
1106118097 13:26834156-26834178 CTTTAAAGTCAGATGGACCCTGG + Intergenic
1106674593 13:31945108-31945130 CTTTAAACTAAAATGGTCAATGG - Intergenic
1110682084 13:78326003-78326025 CTTTAAACTCAGAAGGTGAATGG + Intergenic
1111097851 13:83538225-83538247 CTTTAAGGTCAAATGGACAATGG - Intergenic
1112201372 13:97279225-97279247 CTTTGAAATCAGAAGGACCAGGG + Intronic
1112719830 13:102230715-102230737 CTTATAACTGAGATGGATTAGGG - Intronic
1114944851 14:27667571-27667593 CTTTAAACTCAGTGAGTCTAGGG + Intergenic
1118639887 14:67782563-67782585 GTTTAAAGTCAGATGGACTTGGG + Intronic
1121656423 14:95599677-95599699 CTTTAAGCAAAGATAGACTAGGG - Intergenic
1123796733 15:23780195-23780217 CTTTAAAATCTGATGGGGTAAGG + Intergenic
1124509755 15:30313568-30313590 CTTTATACTCTGCTGGGCTAGGG + Intergenic
1124733802 15:32225094-32225116 CTTTATACTCTGCTGGGCTAGGG - Intergenic
1124846841 15:33299835-33299857 CTTTAAAATTAGATAGACTAGGG + Intergenic
1134769229 16:16791723-16791745 CTTCAAATTCAGATGGACCTGGG - Intergenic
1135716845 16:24778139-24778161 CTCTAGAATCAGATAGACTAGGG + Intronic
1135737711 16:24945748-24945770 CTTAAAACTCTGCTGGATTAGGG + Intronic
1141029810 16:80577957-80577979 CTTTACACTCTGATGCACCAGGG - Intergenic
1143083439 17:4398041-4398063 CCTTAAACCCTGATGGCCTAAGG - Intergenic
1146137108 17:30332142-30332164 AGTTAAACTCAGATCTACTAAGG + Exonic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1150470731 17:65435163-65435185 CTTTAAATTGGCATGGACTAAGG - Intergenic
1153444112 18:5153026-5153048 CTTGAAACACAGATGGACTTTGG + Intronic
1156379335 18:36543601-36543623 TTTTAAACTCAGCTGGCCTGAGG + Intronic
1157456462 18:47834144-47834166 TTCTAAACTCAGCTGCACTATGG - Exonic
1158041843 18:53103900-53103922 CTAGAAACACAGCTGGACTAGGG + Intronic
1159293694 18:66454031-66454053 CATTAAAATGAGATGGAATATGG + Intergenic
1159346990 18:67218763-67218785 CTTTAAAGTCACATGCCCTAGGG + Intergenic
1160690523 19:459019-459041 CTTTAGACTCAGATGCACAGAGG - Intronic
926195115 2:10758973-10758995 CTTTAAACTTAGTTTGACTTGGG + Intronic
928877561 2:36057962-36057984 CTTCAAAATCAGATAGTCTATGG + Intergenic
929329202 2:40659296-40659318 CTTCAAACACAGATGGCCTCTGG - Intergenic
930244000 2:48964763-48964785 CTTTAAACCCAAATGTACAAGGG + Intronic
931248136 2:60507971-60507993 CTTTAAAATCATATGGTCTTCGG + Intronic
931897592 2:66749949-66749971 TTTTAAACTTAGAGAGACTAAGG + Intergenic
931996036 2:67840094-67840116 CTTTAAATTCAAATGGACCTGGG - Intergenic
932399868 2:71472975-71472997 CTTTAAACTCAGAAGGCCTGGGG - Intronic
933559022 2:83868533-83868555 TGTTAAACTCAGAATGACTACGG - Intergenic
936541598 2:113356119-113356141 GTTTAAACACAGATGGCCCAAGG - Intergenic
940158792 2:150689211-150689233 CTTTAAAATCAGATAGACCTGGG - Intergenic
940662765 2:156568107-156568129 CCTTAAACTCAGAAGGAAGAAGG + Intronic
941714320 2:168748141-168748163 CTGTACACTCAGATGGCCAATGG + Intronic
943218334 2:185069337-185069359 CTTTAAACACAGGTGGCCCAGGG - Intergenic
944150962 2:196558238-196558260 TTTCAAACTCAGATGGGCTATGG + Intronic
945763035 2:213938320-213938342 TTTTTACCTCAGATGGACTATGG - Intronic
945906431 2:215598672-215598694 CTTTAAAAACAGATGTTCTACGG - Intergenic
946651857 2:221900245-221900267 TTTTACACTCAGATGAACCAGGG - Intergenic
1170100654 20:12695914-12695936 CTCTAGACTCAGAGGGACTTGGG - Intergenic
1171114612 20:22513838-22513860 ATTTAGACCCAGATGGACAACGG - Intergenic
1174852197 20:54006261-54006283 CCCTAAACTCACATGCACTAGGG + Intronic
1179341901 21:40519495-40519517 CTTTATCCTCAGATGGCCAAAGG - Intronic
1180698712 22:17770194-17770216 CTTAAAATGCAGATGGACTTGGG - Intronic
1182335045 22:29578470-29578492 CTTTGAAATCAGATGGACCTGGG - Intronic
1184091653 22:42296078-42296100 CACAAAACTCAGATGGGCTAAGG - Intronic
949167554 3:960339-960361 CTTTAATATCAGAAGGACTCAGG + Intergenic
949525024 3:4894986-4895008 CTTTAAGCTCAGCTGGAGAATGG - Intergenic
949568113 3:5264210-5264232 CTTCAAAATCACATGGGCTAAGG - Intergenic
951362418 3:21740688-21740710 CTTTGAACTCAGACTGACTTGGG + Intronic
952082428 3:29776277-29776299 CTTTGGAATCAGATGGACTTTGG + Intronic
955062253 3:55503499-55503521 CTATAAACCCAGATGCACTCAGG + Intergenic
957252338 3:77789278-77789300 CTTATAACTGAGATGGGCTAGGG + Intergenic
959806956 3:110566738-110566760 AGTTAAACTCAGATTGACTTTGG + Intergenic
960738364 3:120804784-120804806 CTTTAATGTCAGATAGACCAGGG + Intergenic
962953910 3:140246876-140246898 CTATGAATTCAGATGGACTTGGG + Intronic
963916427 3:150862725-150862747 CTTTCCACACAGATGGACTGAGG - Intergenic
964989665 3:162793142-162793164 GTTTAAATTCAGAAGGAATATGG + Intergenic
971010026 4:22423774-22423796 TATTAGGCTCAGATGGACTATGG + Intronic
971416483 4:26436491-26436513 CTTTAAATTCTGATGTTCTATGG + Intergenic
975367131 4:73542334-73542356 CTTTGAAGTCAAATGGACTTTGG - Intergenic
975817049 4:78229103-78229125 CTTTGAAATCAGATGGACACTGG + Intronic
976236127 4:82899608-82899630 CTTAAAAGTCACATGGCCTAAGG - Intronic
976947619 4:90790108-90790130 ATTTAAACTAAGATGGGTTATGG - Intronic
978403085 4:108350921-108350943 CTTTCTCCTCAGATGGACAATGG + Intergenic
978641812 4:110879553-110879575 GTTTAAACCCAGATGCACTGAGG - Intergenic
986846322 5:11759886-11759908 GTTTGAACTCACATGGCCTATGG + Intronic
989624117 5:43413243-43413265 GTCCAAACTCAGATGTACTATGG + Intergenic
990316484 5:54587743-54587765 CTTTCAATTCAGATGGTCTGTGG + Intergenic
992367340 5:76106147-76106169 CTATCAACTCAGATGGGGTAGGG - Intronic
993899476 5:93574617-93574639 CTTTAAACTCAGAGTGGCTAAGG - Intergenic
995558932 5:113359861-113359883 TCTTAAACTCATATGGACCATGG - Intronic
996028246 5:118675841-118675863 CCTTTACCCCAGATGGACTAAGG + Intergenic
996528984 5:124507752-124507774 CTTCTAACTCAGATAGACTTGGG - Intergenic
997300420 5:132799638-132799660 CTTTGAACTCAGATGACCTGAGG - Intronic
998498422 5:142611208-142611230 CTTGAAACTCAGAAGGGCTCTGG + Intronic
998791776 5:145773577-145773599 AATTAAGCACAGATGGACTAAGG - Intronic
999467618 5:151822478-151822500 ATTTAACCTCAGATGGGCTGTGG - Intergenic
999596769 5:153214117-153214139 TTTTAAACTGAGATGGTCTAAGG + Intergenic
1001360560 5:171081108-171081130 CTTTAAACTCAGATGGACTAGGG - Intronic
1001877443 5:175213576-175213598 CTTGGGAGTCAGATGGACTAAGG - Intergenic
1004717898 6:18236125-18236147 CTTTAAACTAACATAAACTAAGG + Intronic
1006693079 6:35907403-35907425 CTTTAAAATAAGATGGAGTGAGG + Intronic
1008167613 6:48158728-48158750 CTTAAAATTAAGTTGGACTATGG - Intergenic
1010034614 6:71310432-71310454 CTTTGAAGCCAGATGGACTTTGG + Intergenic
1010376668 6:75178513-75178535 CTTGAAGCTAAGATGCACTATGG + Intronic
1015026605 6:128541016-128541038 CTTTAAAAACAGCTGGATTATGG - Intergenic
1018080940 6:160258905-160258927 CTTTGAAGTCAGCTGGACCAAGG - Exonic
1018973803 6:168548251-168548273 ATTTACACCCAGATGGACTTGGG - Intronic
1022621735 7:31991415-31991437 CTTTGAACTCAAACAGACTAGGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1028402890 7:90443417-90443439 TTTTAAACTCAGATGATGTAAGG + Intronic
1029563618 7:101320593-101320615 AATAAAGCTCAGATGGACTAAGG - Intronic
1030634740 7:111936054-111936076 CTTTAAACTAACATGGGCTTAGG + Intronic
1030683443 7:112457241-112457263 CTTGAAACTAAGAAGGATTAGGG + Intronic
1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG + Intergenic
1032390848 7:131554713-131554735 CCTTAAGCTCAGAAGCACTAGGG + Intronic
1034928333 7:155140938-155140960 GCTGAAACTCAGAGGGACTACGG - Intergenic
1038701561 8:29854271-29854293 CTTGGAATTCAAATGGACTAGGG + Intergenic
1039021715 8:33214864-33214886 CTTTAAAATCAGTTGTACTGAGG - Intergenic
1040587669 8:48758472-48758494 CTTTAACTTCAGAGGGGCTATGG + Intergenic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1045172219 8:99684397-99684419 CTTAATGCTCAGAGGGACTAGGG - Intronic
1045741408 8:105364850-105364872 CTTTTAACTCTGAAGGTCTATGG + Intronic
1047078989 8:121438319-121438341 CCTTAAAATCAGTTGAACTATGG + Intergenic
1048595882 8:135865305-135865327 GGTTAAATTCAGATGGACTTGGG + Intergenic
1051531785 9:18112247-18112269 AGGTGAACTCAGATGGACTAAGG - Intergenic
1052823963 9:33161926-33161948 CTTTGCACTCAGCTGGGCTATGG - Intronic
1052991221 9:34520412-34520434 CTTGAACCTCAGATGGACATGGG - Intronic
1059214127 9:112544398-112544420 CTTTAAATTCAGTGGGAATAGGG + Intronic
1061055663 9:128221539-128221561 CTTTAAACCCAGAGGGTCCAAGG + Intronic
1187356157 X:18573878-18573900 CTTTAAACTCAGTTTGAGTTGGG + Intronic
1189377518 X:40477084-40477106 CTGTAAACACAGATACACTAGGG - Intergenic
1193582270 X:83280829-83280851 CTCAAAACTCAGATTGACTGGGG - Intergenic
1194568875 X:95528201-95528223 CATTAAATTCAAATGGATTAAGG + Intergenic
1195514472 X:105757594-105757616 CTTTAAAATCAGACTGAGTAGGG + Intronic
1195736360 X:108016847-108016869 CTTTAGAGTCAGAGGGACTTGGG + Intergenic
1197484091 X:127025486-127025508 TTTTAAACTAAGAAGAACTAAGG + Intergenic