ID: 1001369868

View in Genome Browser
Species Human (GRCh38)
Location 5:171188337-171188359
Sequence TCACCAACACAGCAGCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001369868 Original CRISPR TCACCAACACAGCAGCCAAG AGG (reversed) Intronic
901354432 1:8631679-8631701 CAACCAACACAGCTGACAAGGGG - Intronic
901703163 1:11056153-11056175 TCACCCACACAGCTACCAGGTGG + Intronic
902053984 1:13584916-13584938 CCACCAACACAGCAACCCAGCGG - Intronic
903299665 1:22369802-22369824 TCTCCAACACAGCCACCAAGCGG + Intergenic
903999893 1:27332943-27332965 TCCCCTACACAACAGCCAGGGGG + Intronic
904913741 1:33954521-33954543 GCACTATCACAACAGCCAAGCGG + Intronic
905518191 1:38577724-38577746 TCACCCTCCAAGCAGCCAAGTGG - Intergenic
905984101 1:42261348-42261370 TCCCCAAAAAAGCAGCAAAGTGG + Intronic
906798016 1:48712877-48712899 ACACCAAAACAGCAGCTATGAGG + Intronic
908984366 1:69999027-69999049 TCTCCTCCCCAGCAGCCAAGTGG + Intronic
909369612 1:74868990-74869012 TCACAAAAACAGCACCAAAGGGG - Intergenic
918432583 1:184477398-184477420 TGACCAACTCAGCAGCAAGGTGG + Exonic
919583859 1:199410903-199410925 TCCCCAACAGAACAGCCAATAGG + Intergenic
919715989 1:200777107-200777129 TCATCAACACTGCAGCCATATGG + Intronic
919756643 1:201070242-201070264 TCACCCCCACAGCAGCCAAGGGG + Intronic
921146855 1:212366641-212366663 TCAGCTTCACAGCAGTCAAGTGG - Intronic
921229180 1:213051308-213051330 TCCCCAACGCAGCGGCGAAGCGG - Exonic
921460840 1:215424811-215424833 ACACCAAAACAGCAGCAAAACGG + Intergenic
922190890 1:223317392-223317414 CCATAGACACAGCAGCCAAGAGG - Intronic
923594692 1:235351995-235352017 TAACCCATACAGAAGCCAAGGGG + Intergenic
1063140128 10:3248783-3248805 TCACCAACGCAGCAGCTCAGAGG - Intergenic
1068706393 10:60080810-60080832 GCACCAACACAGCAGACTACAGG + Intronic
1071853194 10:89596374-89596396 ATACCAACACATCAGCCAATGGG - Intronic
1076340708 10:129743073-129743095 CCACCCACATAGCGGCCAAGGGG - Intronic
1077146661 11:1049560-1049582 GCACCGTCACAGCAGCCAAGGGG + Intergenic
1080126822 11:28744759-28744781 TCACAAAAACAGCACCAAAGGGG + Intergenic
1081772009 11:45655908-45655930 CCACCCACACAGCAGACAGGGGG + Intronic
1082131858 11:48500002-48500024 TCACCAACACACTATCCCAGTGG + Intergenic
1082565326 11:54670620-54670642 TCACCAACACACTATCCCAGTGG + Intergenic
1083629174 11:64086994-64087016 CCACCTACACAGCAGCCACGTGG + Intronic
1085581000 11:77650406-77650428 TTCCCGACACAGTAGCCAAGTGG + Intergenic
1086037256 11:82431683-82431705 TCGCCAAGATCGCAGCCAAGAGG + Intergenic
1088887679 11:114020625-114020647 TCTCCAAAACAGCTGCCCAGAGG - Intergenic
1091224550 11:133949794-133949816 TCTCCATCACAGCAGCTCAGAGG + Intronic
1091471325 12:730679-730701 TCACCAGAACAGCACCAAAGGGG + Intergenic
1092888760 12:12949511-12949533 CTACCAACACAGCTTCCAAGTGG - Exonic
1097991315 12:65837004-65837026 TCACAAACAAAGCAGGTAAGTGG - Intronic
1101858121 12:108461076-108461098 GCACCCACTCTGCAGCCAAGGGG + Intergenic
1101987496 12:109458891-109458913 TCACCCACAATGCAGCCCAGTGG + Intronic
1104268498 12:127260788-127260810 TCCCCCAGACAGCAGCCAACTGG + Intergenic
1106921154 13:34564723-34564745 TCACCAAAACAGCATGGAAGTGG + Intergenic
1107045458 13:35987980-35988002 TCACCAGCACAGCACGCAGGAGG - Intronic
1108243658 13:48493391-48493413 TCCTCAACACAGCAGCCAGGAGG + Intronic
1110760736 13:79227935-79227957 CCACCACCACAGCAGCAAAGGGG - Intergenic
1111050838 13:82882013-82882035 TAAGCAACAAAGCAGTCAAGAGG + Intergenic
1115383121 14:32762602-32762624 TCAGCTACACAAAAGCCAAGAGG + Intronic
1117507226 14:56415817-56415839 TAACCATCACAACAACCAAGGGG + Intergenic
1117779083 14:59213830-59213852 TCACAAACACAACAGGGAAGGGG - Intronic
1118675138 14:68176083-68176105 TAACGAACACAGCATCCAAATGG - Intronic
1121738918 14:96237860-96237882 TCAGCAAGACAGTAGCCAAGGGG - Intronic
1124036156 15:26055042-26055064 TAACCAAGACAGAAGCCAAAAGG + Intergenic
1125516066 15:40322170-40322192 TCAGCAGCACAGAAGTCAAGTGG - Intergenic
1125869519 15:43086358-43086380 TCACCAATACAGAAGGAAAGTGG + Intronic
1131224682 15:90614446-90614468 TCACCATCACAGAAACCTAGCGG - Exonic
1131285369 15:91052506-91052528 TCACCAATACAGCACCAAAAGGG - Intergenic
1131442271 15:92467932-92467954 TCAACAAGTCAGAAGCCAAGTGG + Exonic
1131474016 15:92720884-92720906 TCACAAAAACAGCACCAAAGGGG + Intronic
1132235309 15:100215703-100215725 TTACCTACAGAGCAGCCCAGGGG - Intronic
1134916159 16:18072831-18072853 TCACCCCCAGAGCAGCCAAGAGG + Intergenic
1135960000 16:26987524-26987546 TAATCAGCACAGCAGCCAGGAGG - Intergenic
1136581389 16:31153278-31153300 TCCCCAACCCAGCAGACATGAGG + Intergenic
1138480988 16:57303402-57303424 TCCTCCACACAGCAGCCAAAGGG - Intergenic
1141224271 16:82100513-82100535 TCACTAAAACAGCACCAAAGGGG + Intergenic
1141552568 16:84815939-84815961 TCTCCAACAAGGCAGACAAGTGG + Intergenic
1143097999 17:4488786-4488808 TCCCCACCCCAGCACCCAAGTGG - Intergenic
1143110548 17:4550405-4550427 TTAACAACCCAACAGCCAAGGGG + Intronic
1143333461 17:6155349-6155371 TCACGCACACAGCTGGCAAGTGG - Intergenic
1148153181 17:45408519-45408541 TCAGCCACACAGCAGCCTGGAGG - Intronic
1150365574 17:64580938-64580960 TCATCAACAAAGCAGCTAAGAGG + Exonic
1151968647 17:77445588-77445610 ACAGCAACACAGCAGCAGAGAGG - Intronic
1152739436 17:82012556-82012578 GCCCCAGCACAGCAGCCCAGGGG - Intronic
1152937931 17:83151521-83151543 ACACCAAGACAGCAGCCCCGAGG + Intergenic
1153380794 18:4437066-4437088 ACAACAATAAAGCAGCCAAGGGG + Intronic
1156384861 18:36595550-36595572 ACACCACCACAGCAGAGAAGAGG - Intronic
1157306466 18:46521111-46521133 TCACCACCATGGCATCCAAGAGG + Exonic
1159371699 18:67535683-67535705 TTACCAAGACAGCAGCAAAGGGG + Intergenic
1160898958 19:1417175-1417197 TCACCTGCACTGCTGCCAAGTGG - Intronic
1161232468 19:3181194-3181216 CCACCAACACAGCAGCTGTGAGG + Intergenic
1161641357 19:5425393-5425415 GCATCCACACAGCAGCCAGGAGG + Intergenic
1163286084 19:16348890-16348912 CCTCCAATACAGCAGACAAGAGG - Intergenic
1163509412 19:17726233-17726255 TCACCAGCACGGCATCCACGCGG - Exonic
1163545945 19:17941679-17941701 CCACCAGCACAGCAGGAAAGTGG - Intronic
1165333332 19:35153691-35153713 TCTCCATGACAGCAGCCAGGAGG + Intronic
1165747800 19:38240647-38240669 TTACCAGCACAGAAGCCAGGAGG + Intergenic
1165915509 19:39256612-39256634 ACACCCACACAGCAGCAAAGTGG - Intergenic
925750939 2:7090226-7090248 TCATCAAGACAGCAGCCCAGCGG - Intergenic
925919239 2:8627888-8627910 TCCCCAGCACAGCAGCCGCGGGG + Intergenic
926205745 2:10833391-10833413 TCAGAGACACAGCAGCAAAGTGG - Intronic
929526872 2:42712404-42712426 CCACCTACTCAGAAGCCAAGAGG - Intronic
930428194 2:51238150-51238172 TCACTAACACAGAATCCATGTGG + Intergenic
932578108 2:72973759-72973781 TCACTAACACAGAGGCCAGGTGG - Intronic
932952953 2:76315573-76315595 TCACAAAGACAGCAGCACAGGGG + Intergenic
934049330 2:88197390-88197412 TGACTAATACACCAGCCAAGAGG + Intergenic
934938026 2:98479256-98479278 TCAGCACCACTGCAGCCAAATGG - Intronic
939655960 2:144825688-144825710 TAACCAAAACAGCATCCCAGAGG + Intergenic
940512571 2:154637195-154637217 TCACCAACACTGCAAGCAAAAGG - Intergenic
940918228 2:159281562-159281584 TCACCACCACACCAGGCATGAGG + Intronic
941335752 2:164241300-164241322 TAACCAACAAAGCATTCAAGAGG - Intergenic
941382557 2:164813522-164813544 TCACCAACTCAGCAGCCAGGTGG - Intronic
943532353 2:189098973-189098995 GCACCAACACTGGAGCCAAGGGG + Intronic
943539310 2:189192097-189192119 GCATCAACACAGCAGAGAAGTGG + Intergenic
943620098 2:190139661-190139683 TCACAAAAACAGCAGCATAGGGG + Intronic
945971871 2:216238651-216238673 TCACCAACTCAGCCGCCATATGG + Intergenic
947552239 2:231054631-231054653 TGACACACACAGCATCCAAGTGG + Intergenic
947917672 2:233844668-233844690 GGATCAACACAGCAACCAAGAGG + Intronic
1169789958 20:9399450-9399472 ACATCAACACAGCAGGCAAGGGG + Intronic
1170804999 20:19621843-19621865 TCACAAACATAACAGCTAAGAGG - Intronic
1172019749 20:31905692-31905714 ACACCAACCCAGCAGCCACAAGG + Intronic
1172193516 20:33076698-33076720 TCAGCCACACAGGAGCCAGGGGG - Intergenic
1172601504 20:36186821-36186843 TATCCCACACAGCAGCCCAGAGG + Intronic
1172970358 20:38868810-38868832 TGACCAGCACTGCAGTCAAGAGG + Intronic
1173268899 20:41513630-41513652 TCAACAACAAAACAGCCCAGTGG + Intronic
1173903055 20:46604941-46604963 TCACCTGCACAGCACCCAGGTGG - Intronic
1174191454 20:48743463-48743485 TCCCCCTCACAGCAGCCAAAGGG + Intronic
1174372217 20:50098914-50098936 TCATCTGCACAGCAGCCAACTGG + Intronic
1174432968 20:50484108-50484130 TTACCAAGACAGAAGTCAAGAGG + Intergenic
1175604735 20:60303425-60303447 TCTCCAGCACAGCACCCCAGGGG + Intergenic
1176105349 20:63383283-63383305 TCACATCCTCAGCAGCCAAGTGG + Intergenic
1176139565 20:63539048-63539070 TCCCCAGCACAGCAGCCTGGGGG - Intergenic
1178405391 21:32319160-32319182 AGACCAACACAGCATCCAAGAGG + Intronic
1179319950 21:40281030-40281052 TTCCCAACATTGCAGCCAAGGGG - Intronic
1180939651 22:19650295-19650317 TCAACAACACAGTAACCAATGGG + Intergenic
1180967056 22:19795864-19795886 CCACCAGCACAGCCACCAAGAGG + Intronic
1181018659 22:20086450-20086472 TCACCAACACTCCCGCCAAAGGG - Exonic
1184920846 22:47604752-47604774 TCATCCTCACAGCAGCCAATAGG - Intergenic
950088773 3:10279949-10279971 ACACCCACACAGCAGCCCTGAGG - Exonic
951475404 3:23100451-23100473 TCACCAGAACAGCACCAAAGAGG + Intergenic
953228209 3:41040337-41040359 TCAATAAAACAGCTGCCAAGTGG + Intergenic
953598117 3:44337135-44337157 TCCCCAACACAGAACCCAATTGG - Intergenic
955356305 3:58235996-58236018 TCACCAAAACAGGAGTCCAGGGG - Intergenic
955743133 3:62113306-62113328 TCAGAAACACAGCAGCCAGCTGG + Intronic
955839913 3:63101253-63101275 TCAGCAACACAGCAACTAACAGG + Intergenic
957439513 3:80225579-80225601 TAACCAAAACAGCAACAAAGAGG + Intergenic
960007987 3:112801065-112801087 TACCCAACAATGCAGCCAAGTGG - Intronic
960054076 3:113264353-113264375 TCTCAAACACACCAGCCAACAGG + Intronic
961262656 3:125615123-125615145 TAACCATCACAGCATCCTAGAGG - Intergenic
961472036 3:127121472-127121494 TCACCAACGCTGCAGCCCACAGG + Intergenic
962342504 3:134597186-134597208 GCCTCAACACAACAGCCAAGAGG - Intergenic
963045497 3:141099989-141100011 TCAGCCATACAGCAGCCATGTGG + Intronic
963378304 3:144497645-144497667 TCAACAACAAAGCACCAAAGAGG + Intergenic
965979711 3:174673002-174673024 TAATCAACACCGCAGCCAAAGGG - Intronic
966200144 3:177353582-177353604 TCCACAACACAGCAGCCAAGGGG - Intergenic
967178385 3:186882001-186882023 TCACCAACACTCCAGGCAACGGG - Intergenic
968597497 4:1493001-1493023 TCGCCAGCACAGCTGCCACGGGG - Intergenic
968816980 4:2827370-2827392 TCTCCTCCACAGCGGCCAAGAGG - Intronic
969674404 4:8607047-8607069 TCACCAACACCCCAGCAAGGAGG - Intronic
970697889 4:18698706-18698728 TCACTCACACAGCAGTCCAGAGG - Intergenic
973555158 4:52075054-52075076 TCACCAACATACCTGACAAGGGG - Intronic
973695173 4:53483715-53483737 TCACCACCACAACAGAGAAGGGG + Intronic
975835647 4:78419917-78419939 TCACCAGGACAGCACCCAGGGGG + Intronic
976013553 4:80521894-80521916 GCATCATCACAACAGCCAAGAGG - Intronic
976987495 4:91320060-91320082 TAACCAAGACAGCTGCTAAGTGG - Intronic
977178744 4:93846655-93846677 TCACAAATACAGCATCAAAGGGG - Intergenic
977302355 4:95282222-95282244 TTAGCATCAGAGCAGCCAAGAGG + Intronic
977825956 4:101531825-101531847 TCACCAAAACAGCAGGGTAGTGG - Intronic
978144731 4:105359077-105359099 CCACCAACCCAGAAGCCCAGTGG - Intergenic
983987941 4:174082656-174082678 TCACCAGAACAGCACCAAAGAGG + Intergenic
985418768 4:189762206-189762228 CCACCAACAAAGCAAGCAAGAGG + Intergenic
985748542 5:1661476-1661498 CCAGCAGCACAGCAGCCAAATGG - Intergenic
985926814 5:3025640-3025662 CCAGGAGCACAGCAGCCAAGGGG - Intergenic
986811854 5:11368383-11368405 ACACCAACCCCACAGCCAAGTGG - Intronic
987710219 5:21495160-21495182 CCACCTACGCAGCAGACAAGGGG + Intergenic
987719708 5:21617828-21617850 TCACCAGAACAGCATCAAAGGGG + Intergenic
988749394 5:34179013-34179035 CCACCTACGCAGCAGACAAGGGG - Intergenic
989816024 5:45738380-45738402 TCTGCCACACAGCAGCCATGGGG - Intergenic
990133630 5:52618851-52618873 TCACTATCACAACAGCAAAGGGG - Intergenic
990380725 5:55220396-55220418 TCACCATCAGAACAGCCAACGGG - Exonic
990918319 5:60934939-60934961 TCACCAAAACAGCATGCTAGTGG - Intronic
991281311 5:64917441-64917463 TAACCAACACATCAGACAAAAGG - Intronic
991737649 5:69642205-69642227 CCACCTACGCAGCAGACAAGGGG - Intergenic
991760545 5:69914220-69914242 CCACCTACGCAGCAGACAAGGGG + Intergenic
991786787 5:70203881-70203903 CCACCTACGCAGCAGACAAGGGG - Intergenic
991789225 5:70221931-70221953 CCACCTACGCAGCAGACAAGGGG - Intergenic
991817107 5:70518321-70518343 CCACCTACGCAGCAGACAAGGGG - Intergenic
991839776 5:70789270-70789292 CCACCTACGCAGCAGACAAGGGG + Intergenic
991879233 5:71204266-71204288 CCACCTACGCAGCAGACAAGGGG - Intergenic
991881673 5:71222295-71222317 CCACCTACGCAGCAGACAAGGGG - Intergenic
991925814 5:71704040-71704062 TCTCCAACACAGCAGCCATAGGG - Intergenic
991933239 5:71776440-71776462 TCCCCAACACAGCAGACATTAGG - Intergenic
992532700 5:77667531-77667553 TTACCAAGACAGCAGCCTGGAGG + Intergenic
992685463 5:79195190-79195212 GCACACAGACAGCAGCCAAGGGG + Intronic
994460199 5:100062275-100062297 CCACCTACGCAGCAGACAAGGGG - Intergenic
994484347 5:100375700-100375722 CCACCTACGCAGCAGACAAGGGG - Intergenic
997206657 5:132054146-132054168 TTAGGAGCACAGCAGCCAAGCGG + Intergenic
997208287 5:132063299-132063321 TCACCCAGACAGCATCCACGTGG - Intergenic
997249450 5:132377296-132377318 TCACCAACAACGCAGGCAAGGGG - Intronic
998155495 5:139784451-139784473 TCTCTAACACAGCAGCCAGAGGG + Intergenic
998352554 5:141511085-141511107 TGACCAACGCAGCTGGCAAGCGG + Exonic
998683943 5:144503160-144503182 TCACTCACACAAAAGCCAAGAGG + Intergenic
999185860 5:149708155-149708177 GCACCAAAACAACAGCCAGGTGG - Intergenic
999670395 5:153954514-153954536 TTTCCAAAACAGCAGCCCAGTGG - Intergenic
1000701900 5:164461604-164461626 TCTCCCACACAGCAGCCCAGGGG - Intergenic
1001044674 5:168362799-168362821 TCACCAACCCAGCAGGGCAGAGG + Intronic
1001133774 5:169085435-169085457 CAACTAACACAGCAGCAAAGGGG + Intronic
1001369868 5:171188337-171188359 TCACCAACACAGCAGCCAAGAGG - Intronic
1003055945 6:2820414-2820436 TCACCAAGCCAGCAATCAAGTGG - Intergenic
1003339654 6:5207374-5207396 TCATATACACAGCAGGCAAGGGG + Intronic
1005130539 6:22502593-22502615 TTACCAACACAGCAGCCAAAGGG - Intergenic
1005547468 6:26885359-26885381 CCACCTACGCAGCAGACAAGGGG - Intergenic
1007210333 6:40188771-40188793 TCAACAACACAACAGACAAATGG - Intergenic
1009018230 6:57926426-57926448 TCACCTATGCAGCAGACAAGGGG - Intergenic
1010760398 6:79716033-79716055 TCACCAACGTTGCAGGCAAGGGG - Intergenic
1012248424 6:96953110-96953132 TCACCAAGACAGCAGTCTTGTGG - Intronic
1018178429 6:161199335-161199357 TGACCATCACACCAGCCATGTGG - Intronic
1018450904 6:163906570-163906592 TCGCTCACACAGCAGCCAAGAGG + Intergenic
1019331115 7:461386-461408 TCACCAGCAGGGCAGCCCAGAGG + Intergenic
1019387245 7:764301-764323 TCACACACACAGCACCCATGCGG - Intronic
1019408681 7:897388-897410 TCACCAGCACAGCTGCCTTGGGG + Intergenic
1020211945 7:6164264-6164286 CCATCTACACAGCACCCAAGGGG - Exonic
1024668584 7:51569386-51569408 CCAGCAATAAAGCAGCCAAGGGG + Intergenic
1025842689 7:65165844-65165866 CAACCAACACAGCAGCACAGAGG - Intergenic
1025880356 7:65530124-65530146 CAACCAACACAGCAGCACAGAGG + Intergenic
1025893081 7:65672480-65672502 CAACCAACACAGCAGCACAGAGG - Intergenic
1027194649 7:76021393-76021415 TCACCTACAGAGCAGTTAAGGGG - Intronic
1027595666 7:80170716-80170738 TCACCAGAACAGCACCAAAGGGG + Intronic
1028606860 7:92664421-92664443 GCACCAACACAGTAACCAATGGG + Intronic
1031707650 7:125000975-125000997 TGAGCAACAGAGCATCCAAGAGG + Intergenic
1031856827 7:126933143-126933165 TCACAAACACAGCTGCAATGTGG + Intronic
1032164163 7:129532773-129532795 TCTCCACCACAGCAACCTAGGGG - Intergenic
1032560315 7:132884124-132884146 TGCCCAACACAGCAGCCAGAGGG + Intronic
1032794399 7:135266205-135266227 TCACCAAGACAGCTACTAAGGGG + Intergenic
1033051566 7:138008995-138009017 TCTCCAACACTGCCACCAAGTGG + Intronic
1034959565 7:155356748-155356770 TCACCACCACAGCTGCCAACAGG + Intergenic
1035237209 7:157506319-157506341 TCACCCACACATCTGGCAAGTGG + Intergenic
1035780440 8:2223503-2223525 GCGCCAACACAGCAGCCCTGTGG - Intergenic
1036678328 8:10852638-10852660 ACACAGACACAGAAGCCAAGAGG - Intergenic
1038131557 8:24737916-24737938 TCAGCATCCTAGCAGCCAAGAGG + Intergenic
1040994952 8:53392037-53392059 TCACTACCCCAGCAGCTAAGAGG + Intergenic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1046151427 8:110231482-110231504 GCACCAACACAGCAGGCATCAGG - Intergenic
1047607956 8:126493349-126493371 ACACTAACTAAGCAGCCAAGTGG + Intergenic
1048025998 8:130587142-130587164 TCACCAAGACAGCAGCCGACTGG - Intergenic
1048440943 8:134458546-134458568 TCCACAACCCAGCAGCCAGGGGG - Intergenic
1049192396 8:141295587-141295609 TCCACAACACAGCACCCAGGGGG + Intronic
1049818682 8:144621054-144621076 GCACCAGCACAGCTGCCAACTGG - Intergenic
1051698080 9:19789797-19789819 CCACCAGCAAAGCTGCCAAGAGG + Intergenic
1051845030 9:21442108-21442130 TCACCATGACAGCACCAAAGGGG - Intergenic
1053413488 9:37930600-37930622 TCACCAGCACAGCAATGAAGCGG + Intronic
1055124937 9:72708138-72708160 TCACCAAAACAGCAGGCTACTGG - Intronic
1056137277 9:83642710-83642732 TCCCACACTCAGCAGCCAAGTGG + Intronic
1056698212 9:88878750-88878772 TCCCCAACACAGGAACCAGGAGG + Intergenic
1057394410 9:94666982-94667004 GCACCAACTCAGCAGCCAGCAGG - Intergenic
1058936631 9:109775492-109775514 TAACAACCACAGGAGCCAAGAGG + Intronic
1060826342 9:126690272-126690294 TCACACACACAGGAGCCAGGGGG - Intronic
1061475150 9:130860417-130860439 TCTCTAACACAGTAGCCAATGGG + Intronic
1062094084 9:134694199-134694221 TCGGCAAATCAGCAGCCAAGTGG + Intronic
1185857892 X:3552967-3552989 TCACCATCACACTAGCCAAGTGG - Intergenic
1185857899 X:3553035-3553057 TCACCATCACACCAGCCCGGTGG - Intergenic
1187012322 X:15292872-15292894 CCACCAAAACACCAGCAAAGAGG + Intronic
1187249556 X:17584404-17584426 CCACCAAGGCAGCAGGCAAGAGG - Intronic
1190728943 X:53211929-53211951 TCACCAAAACAGAGGCAAAGAGG + Intronic
1193074882 X:77345287-77345309 TCACCTTCACAGCATCCTAGGGG + Intergenic
1194339081 X:92687055-92687077 TCACCACCACATCAAGCAAGTGG + Intergenic
1199856830 X:151766074-151766096 TCCCCTGCACAGCTGCCAAGGGG + Intergenic
1200267964 X:154655979-154656001 TCCCCACCCCAGCAGCCGAGAGG - Intergenic