ID: 1001370069

View in Genome Browser
Species Human (GRCh38)
Location 5:171191008-171191030
Sequence CAGTCATATTTTTAATTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 8, 3: 70, 4: 567}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001370068_1001370069 2 Left 1001370068 5:171190983-171191005 CCTCGGGTATTTAAACTCTAAGA 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1001370069 5:171191008-171191030 CAGTCATATTTTTAATTACTAGG 0: 1
1: 0
2: 8
3: 70
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001370069 Original CRISPR CAGTCATATTTTTAATTACT AGG Intronic
901260530 1:7867319-7867341 CAGTCACATTCTGAAATACTGGG - Intergenic
902926490 1:19699230-19699252 CAGTTATAATGTTTATTACTTGG - Intronic
904091465 1:27947919-27947941 ATTTCATATTTTTAATTTCTAGG - Intronic
905044758 1:34987134-34987156 CAGTCACATCTTTAATTCCAAGG - Exonic
907120524 1:52004308-52004330 CAGTCACATTCTGAAGTACTTGG + Intergenic
907889839 1:58626216-58626238 CAGGCATATTTCTAGTGACTGGG - Intergenic
908039107 1:60088234-60088256 TAGTCATATTTTGAGGTACTTGG + Intergenic
908186728 1:61659458-61659480 CAGCCATATTTTATATTTCTTGG + Intergenic
908783711 1:67714746-67714768 CAGTCATGTTCTGAATTACTGGG - Intronic
908976081 1:69900176-69900198 CAGTAATATTGTTTATTAGTTGG - Intronic
909382219 1:75011750-75011772 CAGTCATATTCTGAGGTACTAGG - Intergenic
910071599 1:83221045-83221067 CAGTCATATTCTAAGGTACTTGG + Intergenic
910362321 1:86425881-86425903 CAGTCATATTTTTATATGCATGG - Intronic
910498134 1:87856323-87856345 GAGTCATATTTTTAAGTATCTGG + Intergenic
911537452 1:99117321-99117343 CAGTCTTCTTTTAAATTACCAGG - Intergenic
911730209 1:101284588-101284610 CAGTCACATTCTGAAGTACTGGG - Intergenic
912147093 1:106807340-106807362 CAGAAGGATTTTTAATTACTGGG + Intergenic
912601830 1:110943540-110943562 TAGTTATATTTATAAATACTTGG - Intergenic
912765634 1:112407580-112407602 CAGTCACATTTTGAGGTACTGGG + Intronic
913448419 1:118974352-118974374 AAGCCATTTTTTTAATCACTGGG + Intronic
913697853 1:121345187-121345209 TGGTGATAATTTTAATTACTCGG + Intronic
914139702 1:144934864-144934886 TGGTGATAATTTTAATTACTCGG - Intronic
914961206 1:152209936-152209958 CAGTTAGGTTTTTATTTACTTGG + Intergenic
916415893 1:164591591-164591613 CAGACATACTTTTAATTAATTGG - Intronic
916609028 1:166372044-166372066 TAATAATATTTTTAATTTCTAGG - Intergenic
916655306 1:166870180-166870202 GAGTCATATTCTGAAGTACTAGG - Intronic
916864612 1:168842790-168842812 CAGGCATATTTTTAATCAAATGG + Intergenic
916881488 1:169023487-169023509 CAGTCACATTCTGAAGTACTGGG + Intergenic
916992857 1:170263576-170263598 CAGTCATATTCCTAGTTACTAGG + Intergenic
917073619 1:171179944-171179966 CTCTCATTTATTTAATTACTTGG + Intergenic
917402959 1:174671909-174671931 CAGCTATATTTTTAAATATTTGG + Intronic
917999835 1:180482533-180482555 CAGTGATATTGTTAATACCTTGG - Intronic
918243183 1:182637734-182637756 CAGACATATTTTGAGGTACTAGG - Intergenic
919148043 1:193659804-193659826 CTGTAATATTTTTAATACCTTGG + Intergenic
919188098 1:194180668-194180690 CAGTCATCTTTTTAGGTACTGGG + Intergenic
919344674 1:196360529-196360551 CAGTCATATTCTGACATACTGGG - Intronic
920485247 1:206363837-206363859 CGGTGATAATTTTAATTACTCGG + Intronic
920612947 1:207459576-207459598 CAGAGATATATTTAATTACTTGG - Intronic
920879426 1:209866129-209866151 CAGTCACATTCTGAACTACTGGG + Intergenic
921491893 1:215787405-215787427 CATTTATATTTTTAAAAACTTGG - Intronic
921756629 1:218864436-218864458 CAGTCATCATTTTAAAGACTGGG - Intergenic
922888517 1:229040966-229040988 TAGTTATATTTTTAGTTATTTGG - Intergenic
922953020 1:229575016-229575038 CAGTCACATTCTGAAGTACTGGG - Intergenic
923201244 1:231714075-231714097 CAGTCATGTTTTTATCTACCTGG + Intronic
923768454 1:236914895-236914917 CAGTCATGTTTTGAGGTACTGGG + Intergenic
924855517 1:247871486-247871508 TAGACATAGTTTTCATTACTTGG - Intronic
1063955737 10:11264145-11264167 CAGTCATGTTTTTAATTGCACGG + Intronic
1064554655 10:16536166-16536188 CAGTCACATTTTCAGGTACTGGG + Intergenic
1064667976 10:17676855-17676877 TAACCATACTTTTAATTACTTGG + Intronic
1064837242 10:19547171-19547193 TACTCCTATTTCTAATTACTTGG + Intronic
1065178236 10:23099113-23099135 CAGTCACATTTTAAAGTACTGGG + Intronic
1065201662 10:23318289-23318311 CACTCATATTTTTGACTCCTGGG + Exonic
1065210480 10:23397763-23397785 AAGTGATATTTGTAATTATTTGG + Intergenic
1065357870 10:24859956-24859978 CAGTCATATTTTAATTTGGTGGG - Intronic
1066346210 10:34589333-34589355 CAGTCATATTCTGAGGTACTGGG - Intronic
1066517717 10:36182490-36182512 CTGGGATACTTTTAATTACTTGG - Intergenic
1066641601 10:37559644-37559666 CAGTCACATTTTGAGGTACTGGG + Intergenic
1066792956 10:39086323-39086345 AAGTTTTATTTTTAATCACTAGG + Intergenic
1067934672 10:50599433-50599455 CAGTCATATTCTTAATTTCCAGG - Intronic
1068133114 10:52920146-52920168 CAGTCACATTTTGAGATACTAGG - Intergenic
1068230408 10:54163964-54163986 CAGTCATATTTCTATGAACTAGG + Intronic
1068618955 10:59156398-59156420 CAAACATAGTTTTAATGACTCGG - Intergenic
1068818175 10:61341939-61341961 CAGACCTACTTTTATTTACTAGG + Intergenic
1068855694 10:61795248-61795270 CAGTCATATTTTGAGGTACTGGG - Intergenic
1069758585 10:70791440-70791462 TACCCATATTTTTACTTACTGGG + Intergenic
1069798326 10:71067293-71067315 AAGTCATATTTTTGGTTGCTGGG + Intergenic
1069963389 10:72092663-72092685 CAGTCACATTCTGAGTTACTGGG + Intergenic
1071019933 10:81041397-81041419 CAGTGGTATTTTTAGTGACTTGG + Intergenic
1071583701 10:86798166-86798188 TAGTCCTATTTTTTTTTACTAGG + Intronic
1071584679 10:86808288-86808310 GTGTCATCTTTTTAATTAATTGG + Intronic
1071967006 10:90861759-90861781 CAGTAATTTTTTTAAATGCTAGG - Intergenic
1072236247 10:93456497-93456519 CAGACATGTTTTTAATTATGAGG + Intronic
1072331378 10:94356304-94356326 CAATCATATTTGTAATATCTAGG - Intronic
1072762788 10:98071532-98071554 AGGTCTTATTTTTAATTAGTTGG - Intergenic
1074227861 10:111505196-111505218 CAGTCACATTCTGAAATACTGGG + Intergenic
1074886156 10:117695407-117695429 CAGTCACATTCTGAAGTACTGGG - Intergenic
1075176242 10:120163931-120163953 CAGTTCTAATTTCAATTACTTGG + Intergenic
1075271228 10:121053516-121053538 CAGTCATATTCTAAAGTACTAGG - Intergenic
1077780325 11:5321291-5321313 CTGTCATATTTTTAATAAGGAGG - Intronic
1078361371 11:10670641-10670663 CAGTCACATTATTATGTACTGGG - Intronic
1078907974 11:15705061-15705083 CAGTCACATTCTAAAGTACTGGG - Intergenic
1078976320 11:16482446-16482468 CAGAAACATTTTTAAGTACTGGG + Intronic
1079578454 11:22031720-22031742 CAGAAATATTTTTAAGGACTTGG - Intergenic
1079590123 11:22173199-22173221 TAGAAATATTTTTATTTACTTGG + Intergenic
1079880867 11:25924423-25924445 AAGTCATATTTTTTATTCCATGG - Intergenic
1080279064 11:30535665-30535687 GAATCATATTTTTAATTCATTGG - Intronic
1080321663 11:31017003-31017025 CAGTCATAATTTTAAAAACTTGG + Intronic
1080621894 11:33993611-33993633 CAGTCACATTGTTCAGTACTGGG + Intergenic
1080872431 11:36248518-36248540 CAGTCAGATTCTGAAATACTGGG + Intergenic
1080915876 11:36658431-36658453 CTGTAATATTTTTAAATTCTTGG + Intronic
1081078067 11:38700372-38700394 CAGTCACATTCCTAAATACTTGG - Intergenic
1081245075 11:40755902-40755924 CAGTCACATTCTGAAATACTGGG - Intronic
1081331639 11:41808269-41808291 CAGTCACATTCTGAAGTACTCGG - Intergenic
1081756200 11:45546492-45546514 CAGTCACATTCTGAGTTACTGGG - Intergenic
1082044919 11:47717573-47717595 CAGTTAGATTTTTATTTGCTGGG - Intronic
1083084039 11:60124182-60124204 GAGTCAGAATTTTATTTACTAGG + Intergenic
1084662338 11:70553432-70553454 CAGTCACATTCTGAAGTACTGGG + Intronic
1084803051 11:71558387-71558409 GAGTCATCTTTTTAAAAACTTGG + Intronic
1085757042 11:79210431-79210453 CAGACATATTTTTCAGTTCTTGG - Intronic
1086552706 11:88070524-88070546 CATTTATGTTTTTAATTCCTGGG - Intergenic
1087334559 11:96826830-96826852 TAGTCACATTTTGAAATACTGGG + Intergenic
1087496863 11:98902490-98902512 TAGTAATATTTTTCATTCCTGGG + Intergenic
1088186134 11:107173219-107173241 CAGTCAGTTTTTCAATTCCTGGG + Intergenic
1088281212 11:108137026-108137048 CTGTCATATTTTTACATCCTTGG - Intronic
1089098186 11:115937304-115937326 CAGTCACATTCTGAAGTACTGGG - Intergenic
1091570906 12:1684834-1684856 ATGACAGATTTTTAATTACTGGG + Intergenic
1091750113 12:3017118-3017140 CTGTCATTTTATTAATTACGGGG - Intronic
1092700612 12:11226731-11226753 CACTCAAATTTTTAATAATTTGG - Intergenic
1092900191 12:13052146-13052168 CTGTCCTAGTTTTAATTTCTGGG - Intronic
1093052487 12:14519215-14519237 TAGTCATATTTTCAGGTACTAGG - Intronic
1093254690 12:16852707-16852729 GATTCATATTTTCAACTACTTGG - Intergenic
1094211677 12:27899973-27899995 CAGTTCTATTTTTAATTCTTTGG - Intergenic
1095398790 12:41791123-41791145 GAGGCATTTTTTTAAATACTAGG + Intergenic
1095925456 12:47575094-47575116 CAGTCATATTTTGAAGTGCTTGG + Intergenic
1097548979 12:61043136-61043158 TAGTAATAATTTTATTTACTTGG - Intergenic
1097704156 12:62850430-62850452 CAGTTAAGTTTTTAATTATTGGG - Intronic
1097758132 12:63429177-63429199 CAGTGATATTTTTAATGAGTTGG - Intergenic
1098346015 12:69504190-69504212 CCCTCATATTTATAATTACCAGG - Intronic
1098824861 12:75283404-75283426 CAGTCATATTCTGAGCTACTGGG - Intronic
1099406941 12:82275200-82275222 CAGCCATGTTTTTAACTACTAGG - Intronic
1099891908 12:88599429-88599451 CAGTCACATTCTGAGTTACTGGG + Intergenic
1099918341 12:88924521-88924543 TAGTCATATTCTTACATACTGGG - Intergenic
1099942300 12:89203056-89203078 CAGTAATATTTTTTAAAACTAGG - Intergenic
1100007370 12:89910390-89910412 CAGTGATATTTTTTATCACCAGG - Intergenic
1100021663 12:90076313-90076335 CAGTCATAATTTTAATAATCAGG + Intergenic
1100447104 12:94670978-94671000 CAGTCACATTCTGAAGTACTAGG + Intergenic
1100784745 12:98066908-98066930 CAGTCACATTCTAAAATACTGGG - Intergenic
1101141539 12:101800817-101800839 CACTCAGATTTTTAATTATAGGG - Intronic
1101199173 12:102416826-102416848 CAGTCATATTTTGACGTACTGGG - Intronic
1101613047 12:106309574-106309596 GAGTAATTTTTTTAATTCCTTGG - Intronic
1102110297 12:110360435-110360457 CAGTTTTTTTTTTAATTACAGGG + Intergenic
1102598404 12:114010900-114010922 TAGTCATATTCTGAAATACTGGG + Intergenic
1104039477 12:125120395-125120417 CACTCATGTTTTTAAATCCTTGG + Intronic
1106490026 13:30212851-30212873 CAGTCACATTCTGAAGTACTGGG - Intronic
1106636452 13:31533740-31533762 CAGTCACATTCTAAACTACTGGG + Intergenic
1106717064 13:32401598-32401620 CAGTCTTTTTTTTAATAAATAGG - Exonic
1106951582 13:34890512-34890534 CAGTCATATTCTGAGGTACTGGG - Intergenic
1107043695 13:35974223-35974245 CAGTCACATTCTCAAGTACTCGG - Intronic
1109151887 13:58857655-58857677 GACTCATATTTTTAATTCCCTGG + Intergenic
1109225680 13:59692086-59692108 AACTTATTTTTTTAATTACTTGG + Intronic
1109564432 13:64093513-64093535 CAATTTAATTTTTAATTACTTGG - Intergenic
1110121222 13:71883953-71883975 CAATCATATTTTAATTTACAGGG + Intergenic
1111095010 13:83501709-83501731 CAGTCATATTTTCAACCTCTGGG - Intergenic
1111250243 13:85592021-85592043 TAGTCATAATTTTAATAAGTTGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1111894334 13:94121937-94121959 GAGTCATATCTTTATCTACTAGG + Intronic
1112123268 13:96436523-96436545 CAGTCATATTTTGAGGTACTGGG - Intronic
1112154168 13:96799079-96799101 CAGTCACATTCTGAATTACTGGG + Intronic
1112530001 13:100191718-100191740 CAGTCATATTTCAAATGGCTGGG + Intronic
1112699862 13:101994805-101994827 AAGGCATATTTTGAATAACTAGG - Intronic
1113273650 13:108703850-108703872 CAGTCACATTCTGATTTACTGGG - Intronic
1113355487 13:109576103-109576125 CAGGCATAGGTTTAATGACTGGG - Intergenic
1114703501 14:24703152-24703174 CAGTTCTATTTTTAATTTTTTGG + Intergenic
1114732988 14:25014195-25014217 CAGCCATATTTTTAACTTTTTGG - Intronic
1115039481 14:28906037-28906059 TAGCCATATTTTTAATTGTTTGG + Intergenic
1115266563 14:31506754-31506776 CAGTCATATTCTGAGATACTGGG + Intronic
1115602255 14:34966727-34966749 AAATCTTATTTTTAATTACTGGG - Intergenic
1115735801 14:36328196-36328218 AAGTCTTTTTTTTAATTTCTGGG + Intergenic
1115952811 14:38740169-38740191 CAGTCACATTCTGAGTTACTGGG + Intergenic
1116053116 14:39828845-39828867 CAGGCATATTTTTATTTCTTTGG + Intergenic
1116350759 14:43859902-43859924 TAGTCATAATTTTGATTACCAGG - Intergenic
1116538131 14:46062041-46062063 CAGTCACATTTTAAGGTACTTGG + Intergenic
1116733965 14:48664887-48664909 GACTCATATTTTAAATTAATAGG - Intergenic
1116909074 14:50438553-50438575 CAGCCATATTTTTTATTATATGG - Intronic
1117452755 14:55866496-55866518 CAGTCATATTATTTATGAATAGG + Intergenic
1118187811 14:63553461-63553483 TAGCCATATATTCAATTACTTGG - Intergenic
1118541053 14:66826145-66826167 CAGTATTATTTTTAATTCCTTGG + Intronic
1118787249 14:69056141-69056163 CATTCCTATTTTTAACTAATGGG + Intronic
1119067096 14:71539849-71539871 CAGTAATAGATTTAATTACTTGG - Intronic
1119094675 14:71817973-71817995 GAGGCATATTTTTAATTTTTAGG + Intergenic
1119254802 14:73185922-73185944 CATTCATATTTTGCAGTACTTGG - Intronic
1119992327 14:79212795-79212817 CACTCATATTTTGAATCTCTAGG + Intronic
1123161743 14:106285619-106285641 CAGTTATCTTTTTGATTTCTGGG - Intergenic
1202847161 14_GL000009v2_random:189088-189110 CAAGCATATTTTTATTTACAAGG - Intergenic
1202916624 14_GL000194v1_random:179650-179672 CAAGCATATTTTTATTTACAAGG - Intergenic
1202876151 14_KI270722v1_random:3411-3433 CAAGCATATTTTTATTTACAAGG + Intergenic
1123803482 15:23846990-23847012 CATGAATATTTTTAATGACTGGG - Intergenic
1123815581 15:23975313-23975335 CAGTTATATTACTTATTACTTGG - Intergenic
1124926433 15:34074736-34074758 CAGTCACATTCTGAAGTACTGGG + Intergenic
1125164918 15:36691573-36691595 CAGTCATATTTTTGTTTTCATGG + Intronic
1125691086 15:41596756-41596778 CACTCATATTTTAAATAACATGG + Intergenic
1126195991 15:45932798-45932820 CAGTCACATTCTAAAGTACTGGG - Intergenic
1126277610 15:46902617-46902639 CAGTCAAATTTTGAAGTACTTGG - Intergenic
1127441331 15:59011780-59011802 CAGACACATTTTGAAGTACTGGG + Intronic
1129052281 15:72792362-72792384 CAGTCACATTTTGAGGTACTAGG + Intergenic
1129555750 15:76507098-76507120 CAGTTATATTCTGAAATACTAGG - Intronic
1130437544 15:83916493-83916515 AAGTAATATTTTTAATTTCTTGG + Intronic
1130583729 15:85162873-85162895 CAGTCATATTCTGAGGTACTAGG - Intergenic
1130863261 15:87909670-87909692 CAGTCATATTCTGAAGAACTTGG - Intronic
1131782870 15:95878555-95878577 CAGTACTATTTTTAAATCCTAGG - Intergenic
1133074891 16:3272418-3272440 CTGTCATGTTTCTGATTACTTGG - Intronic
1133586668 16:7202425-7202447 CAGTTCTATTTTTAATTATTTGG - Intronic
1133673735 16:8049503-8049525 CAGACATATTTTTAAGTAAAAGG - Intergenic
1133977167 16:10607450-10607472 CAGTCACATTCTGAGTTACTGGG - Intergenic
1135818937 16:25662178-25662200 CACACATATTTTTAATTACCAGG - Intergenic
1136058442 16:27707951-27707973 CAGTCATATTCTGAGGTACTGGG + Intronic
1137008006 16:35296505-35296527 CAGTCACATCATTAAGTACTAGG - Intergenic
1137958199 16:52853964-52853986 AAGTCATATATTTATTAACTTGG + Intergenic
1138090798 16:54172835-54172857 GAGTGATATTTTTAATTTATCGG - Intergenic
1138173120 16:54871553-54871575 CAGTCACATTTTTAGGTGCTGGG - Intergenic
1138749711 16:59404079-59404101 TAGTAAGATTTTTATTTACTAGG + Intergenic
1138996239 16:62456458-62456480 TAGTCCTATTTTTAATTTTTTGG + Intergenic
1138999415 16:62491245-62491267 AAGTCATTTTTTTAAATTCTAGG - Intergenic
1139068088 16:63344090-63344112 TAATCTTATTATTAATTACTGGG - Intergenic
1139223825 16:65214527-65214549 AAGACATATTTTTAATTAAAGGG + Intergenic
1139282095 16:65779834-65779856 CAGTCATATTTTTAAATACCAGG - Intergenic
1140016242 16:71188792-71188814 GAGGCATATTTTCTATTACTAGG - Intronic
1140288721 16:73629789-73629811 CAATCATATTTTTAACTAGTAGG - Intergenic
1140298090 16:73728059-73728081 CAGTCACATTTTTAGATGCTGGG - Intergenic
1140594357 16:76391494-76391516 CAGCCAGATCTTTATTTACTAGG - Intronic
1140706303 16:77633437-77633459 CAGTCACATTTTGAGGTACTGGG + Intergenic
1141170955 16:81691386-81691408 CAGTCACATTCTGAAGTACTGGG + Intronic
1143351673 17:6292519-6292541 TAGTCCTATTTTTAATTTTTTGG + Intergenic
1143722800 17:8824621-8824643 CATTCAAATTGTTAATTACAAGG + Intronic
1143939271 17:10522447-10522469 CAGTAATATTTGTAACTTCTGGG - Intronic
1144295799 17:13873788-13873810 CAGTCATATTCTGAGATACTGGG - Intergenic
1144805154 17:17960665-17960687 CAGTCATATTTTAAAAGACTAGG - Intronic
1145122432 17:20272758-20272780 CTATCATATTTTTAACTTCTAGG + Intronic
1146274005 17:31503369-31503391 CAGTCACATTCTGAAGTACTAGG + Intronic
1146959454 17:36960691-36960713 TTGAAATATTTTTAATTACTTGG + Intronic
1147374813 17:40017165-40017187 CAGTCATAGTAATAAATACTTGG - Exonic
1148949127 17:51293938-51293960 TATTCTTATTTTTAATGACTGGG - Exonic
1149520393 17:57314277-57314299 CAGTCATATTTTGAAGTACCAGG + Intronic
1150964457 17:69951951-69951973 CAGTCATGTTTTGAAGTACTGGG - Intergenic
1151080418 17:71323135-71323157 CAGTCATATTTTGACATACTAGG - Intergenic
1151643656 17:75414827-75414849 CAGTCACATTCTTAGGTACTGGG - Intergenic
1151903155 17:77030818-77030840 CAGTCACATTCTGAAGTACTGGG - Intergenic
1153667751 18:7381671-7381693 CAGTCAGTATTTTGATTACTAGG + Intergenic
1154256282 18:12783379-12783401 CAGTCAGATCTTAAATTAGTTGG + Intergenic
1155406845 18:25498032-25498054 CATTAATAGTTTTAAGTACTGGG + Intergenic
1156141039 18:34111934-34111956 CAGTTCTATTTTCAATTTCTAGG - Intronic
1156978540 18:43256934-43256956 CAGTCACATTCTGAAGTACTAGG - Intergenic
1157018932 18:43755744-43755766 CAGTCATATTTTAAAATACTAGG - Intergenic
1157148431 18:45190147-45190169 AAGTGATTTTTATAATTACTTGG + Intergenic
1158322066 18:56274389-56274411 CAGTCATTTTTTTTTTTAATGGG - Intergenic
1158623807 18:59054890-59054912 CAGTCACACTCTGAATTACTGGG + Intergenic
1159358192 18:67364187-67364209 CAGTCAAATTTTAATTTAATTGG + Intergenic
1159414740 18:68130099-68130121 TAGTCATATTTTTGTTAACTAGG + Intergenic
1161516828 19:4701141-4701163 CAGAGATATTTTTAAATAATTGG + Intronic
1162244131 19:9384704-9384726 CACTCATACTAATAATTACTAGG + Intergenic
1165090187 19:33382922-33382944 TAGTTATATTTTTAGTCACTTGG + Intergenic
1167118863 19:47504746-47504768 CACACATATTTTTAAGTATTAGG + Intronic
1167847049 19:52173170-52173192 CAGTCATATTCTGAGGTACTGGG - Intergenic
1168084250 19:54033738-54033760 CAGTCACATTCTGAGTTACTGGG + Intergenic
1202674509 1_KI270710v1_random:29402-29424 CAAGCATATTTTTATTTACAAGG - Intergenic
925500783 2:4501967-4501989 CATTCATATATGTAAATACTAGG - Intergenic
927382485 2:22495187-22495209 TAGTCATATTCTGAAGTACTAGG - Intergenic
927529069 2:23776946-23776968 CAGTCATATTTTAAGGTACTGGG - Intronic
928018712 2:27683601-27683623 CAGTCATATTCTGAGGTACTGGG + Intronic
928303033 2:30143734-30143756 CAGTCACATTTTGAGGTACTGGG + Intergenic
928759848 2:34569191-34569213 TAATCACATTTTTAATTATTGGG - Intergenic
929464263 2:42130679-42130701 AAGTCATATTTTAATTTAGTTGG - Intergenic
929975710 2:46632420-46632442 CTGTCAAATCTTTAATTATTAGG - Intergenic
930000760 2:46860067-46860089 CAGTCACATTGTGAAGTACTGGG - Intergenic
930173423 2:48275610-48275632 AAGTCATATTTTGAGGTACTTGG - Intergenic
930560954 2:52959122-52959144 CAGTCATATTCTGAAATACTGGG - Intergenic
930756481 2:54978827-54978849 CAGTCAGATTTTAAATTTATGGG - Intronic
930805800 2:55488679-55488701 CAGTCATATTCTGAGGTACTGGG - Intergenic
930915037 2:56676486-56676508 CATTCAATTTTTAAATTACTTGG + Intergenic
930927678 2:56839073-56839095 CAGTTTTATTTTTAATTACATGG + Intergenic
931714424 2:65017863-65017885 CAGTCATATTTTAAGTATCTTGG + Intronic
931883399 2:66590196-66590218 CAGTCATATTCTGAGGTACTGGG - Intergenic
933448266 2:82410934-82410956 CAGTCATGGTTTACATTACTGGG - Intergenic
934049287 2:88197029-88197051 CAGTCACATTCTGAAGTACTAGG - Intergenic
934894805 2:98106695-98106717 CAGTCATATTTCTATATACTAGG - Intronic
936231992 2:110710973-110710995 AAGTAAAATTTTTAATTACTTGG - Intergenic
936457253 2:112684420-112684442 AAGTGATATTTTAAATCACTGGG + Intergenic
936549205 2:113420762-113420784 CAGTCATATTCTAAACTACTGGG + Intergenic
936951439 2:117981644-117981666 CATACAATTTTTTAATTACTAGG + Intronic
936993590 2:118391138-118391160 CAGTGAGATTTTGAATTACATGG - Intergenic
937536779 2:122898444-122898466 AACTCATATTTTTAATTCGTTGG + Intergenic
937719435 2:125076476-125076498 CAGTCAGATTTTGTAGTACTGGG + Intergenic
937871673 2:126790741-126790763 CAATCATATTTTTATATATTGGG + Intergenic
938412117 2:131073928-131073950 CGTTCATATTATGAATTACTAGG - Intronic
938831032 2:135050434-135050456 CAGTCACATTTTGAGGTACTAGG + Intergenic
938971025 2:136432509-136432531 CAGTCATATTCTGAGGTACTGGG + Intergenic
938982198 2:136537515-136537537 CAGTTATATTTTGAGGTACTGGG - Intergenic
939321479 2:140628667-140628689 CATTTATATTGTTAATTAATTGG + Intronic
939443483 2:142278802-142278824 CAGGCATTTTTCTAGTTACTGGG - Intergenic
939513467 2:143136648-143136670 CAGTAATATTTTTAAGGATTGGG - Intronic
939740258 2:145897665-145897687 CAGTCACATTCTGAAGTACTGGG + Intergenic
939779271 2:146424289-146424311 CAGTCACATTCTGAAATACTGGG + Intergenic
940150944 2:150599740-150599762 AAGTCATATTTTCATTTTCTGGG + Intergenic
940341774 2:152588983-152589005 CATTCATATTTCTCATTCCTTGG + Intronic
942413001 2:175731213-175731235 CAGTCACATTCTGAGTTACTGGG - Intergenic
942433324 2:175940692-175940714 CAGTCATTTTCATAATTTCTGGG - Intronic
942492874 2:176507367-176507389 CAGTCATATTCTGAGTTACTGGG + Intergenic
942851069 2:180486722-180486744 AAGACATATTTTTATTTACTTGG - Intergenic
942855137 2:180536521-180536543 CAGTGACATTTTTATTGACTTGG + Intergenic
943198134 2:184782129-184782151 CAGTCACATTTTTAAGTACTTGG + Intronic
943426521 2:187743791-187743813 CAGTCATATTTTAATATACTGGG + Intergenic
943431386 2:187806655-187806677 AAGTGAAATTGTTAATTACTAGG + Intergenic
943959220 2:194239785-194239807 TATTTTTATTTTTAATTACTTGG - Intergenic
944748334 2:202681651-202681673 CACTTATACTATTAATTACTGGG - Intronic
945398032 2:209345834-209345856 CAGCCATTTTTTAAAGTACTTGG - Intergenic
945579025 2:211569637-211569659 AAGTCATATATATAAATACTTGG + Intronic
945807537 2:214508691-214508713 AAGTCATATTTTAAATTCCAAGG + Intronic
946048952 2:216845041-216845063 CAGTCACATTCTGAAGTACTGGG + Intergenic
946804235 2:223454104-223454126 CAGTCATATTTTAAAGTACTGGG - Intergenic
947045119 2:225973149-225973171 CAAACACATTTTTAATTATTTGG + Intergenic
948095661 2:235332238-235332260 CAGTCACATTTTGAGGTACTGGG - Intergenic
948199954 2:236122334-236122356 CAGTCACATTCTAAAGTACTGGG + Intronic
948298453 2:236883546-236883568 GAGGCATATTTTTAATCATTTGG + Intergenic
1169822385 20:9726651-9726673 CACTAATACTTTTAAATACTTGG - Intronic
1170496041 20:16926517-16926539 CAGTCATATTCTGAAGTACATGG - Intergenic
1170542139 20:17400051-17400073 CATTCATTTTTTTAATAACATGG - Intronic
1170824311 20:19780587-19780609 CAGTCATATTCTTGAGCACTAGG - Intergenic
1171471419 20:25374971-25374993 CAGTCATATTCTGAAGTGCTAGG - Intronic
1172240701 20:33410856-33410878 CAGGCATGGTTTTAGTTACTGGG - Intronic
1173053820 20:39591967-39591989 CAGCCATACTTTTAATAACTTGG - Intergenic
1173254535 20:41384801-41384823 CAGTCACATTTTGCAGTACTAGG + Intergenic
1176635979 21:9194297-9194319 CAAGCATATTTTTATTTACAAGG - Intergenic
1176637429 21:9260784-9260806 CAAGCATATTTTTATTTACAAGG + Intergenic
1176927900 21:14772387-14772409 CAGTCACATTCTGAAGTACTGGG + Intergenic
1177148687 21:17432979-17433001 CAGTCACATTTTAAGGTACTTGG - Intergenic
1177238892 21:18429984-18430006 CATACATATTTTTAACTACTTGG - Intronic
1177380261 21:20331423-20331445 AAGTCATATTCTGAAGTACTGGG + Intergenic
1178484675 21:33011193-33011215 CAGTCACATTCTTAGGTACTAGG + Intergenic
1178546306 21:33495677-33495699 CAGTCACATTCTAAAGTACTGGG - Intergenic
1179126585 21:38596210-38596232 CTTTCATAGTTTTAATCACTAGG + Intronic
1180421466 22:12868281-12868303 CAAGCATATTTTTATTTACAAGG + Intergenic
1182166606 22:28180818-28180840 CAGGGAAATTTTTAATTACATGG + Intronic
1182540565 22:31038649-31038671 CAGTTTGATTTTTCATTACTTGG + Intergenic
1184626605 22:45737531-45737553 AACTCATATTTTTAATGTCTTGG - Intronic
949667735 3:6360263-6360285 CAGTCATAATTTTACTTGGTTGG - Intergenic
950969994 3:17176780-17176802 CAATCATACTTTTAAGTTCTGGG - Intronic
951216999 3:20034611-20034633 CAGTCACATTCTGAAGTACTAGG - Intergenic
951754300 3:26073034-26073056 GAGTCTTATTATTAATTAATTGG + Intergenic
951865660 3:27304543-27304565 CATTCATCTTTTAAATTCCTTGG - Intronic
951875746 3:27422880-27422902 CAGTCTTACTTTTTTTTACTTGG - Intronic
951896057 3:27610694-27610716 CAGTTAAATTTTTACTTTCTAGG + Intergenic
952012780 3:28920033-28920055 CAGGCATAGTGTTAATTGCTGGG + Intergenic
952243979 3:31564821-31564843 CAATCATACTTTAAATTCCTGGG + Intronic
953252059 3:41254342-41254364 CAGGAATATTTTCAATCACTTGG + Intronic
955760245 3:62272157-62272179 ACGTCATATTTTTATTTATTAGG - Intronic
956577649 3:70771470-70771492 CAGTCATATTCTAAGTTACTGGG - Intergenic
956998823 3:74859819-74859841 CTGTCATTTTTTTAACAACTGGG + Intergenic
957103459 3:75856255-75856277 CAAGCATATTTTTATTTACAAGG - Intergenic
957147329 3:76441202-76441224 AAGACATGGTTTTAATTACTTGG + Intronic
957690654 3:83562061-83562083 CATTAATATATTTAACTACTGGG - Intergenic
958606118 3:96360674-96360696 CAGCCATATTTTTGTATACTGGG - Intergenic
958632620 3:96701964-96701986 GACTCATATCTTTAATTCCTTGG - Intergenic
959004894 3:101008796-101008818 CAGTCACATTTTTTACTCCTAGG + Intergenic
959461545 3:106631772-106631794 AAGTCATATTATTAATTTCATGG + Intergenic
959555472 3:107712323-107712345 GACTCATATTTCTATTTACTTGG + Intronic
960114132 3:113876473-113876495 CACTCATATTTTTCATTTCTAGG + Intronic
960191451 3:114711284-114711306 CAGACATTGTTCTAATTACTGGG - Intronic
960286326 3:115833306-115833328 CAGTCTTATTTTTAGTGGCTGGG + Intronic
961549197 3:127658236-127658258 AAGTCATACTTTTTATTACAGGG + Intronic
961993682 3:131218598-131218620 CAGTCACATTCTGAAGTACTGGG - Intronic
962062237 3:131942101-131942123 CGGTAACATTTTTAAATACTTGG - Intronic
962144807 3:132829644-132829666 CTGTCATATTTTGAGGTACTGGG + Intergenic
962208124 3:133452430-133452452 AAGTCATTTTTTGAATAACTAGG - Intronic
962547939 3:136456342-136456364 CAGTTATATTCTTTATTTCTAGG - Intronic
962910720 3:139847161-139847183 CAGTGATATTCTGAAGTACTGGG - Intergenic
963867736 3:150380650-150380672 TAGTCTTATTTTTAGTTACTGGG - Intergenic
964069488 3:152614406-152614428 AAGTTATATTTTTAAAAACTAGG + Intergenic
964071671 3:152642042-152642064 CAGTCACATTCTGAAGTACTAGG - Intergenic
964179302 3:153864850-153864872 CAGTCATAACTTGAATTTCTTGG + Intergenic
964276796 3:155017242-155017264 CAGTCACATTCTGAGTTACTGGG + Intergenic
964353295 3:155824290-155824312 TAGTCATTCTTTCAATTACTTGG + Exonic
964984326 3:162720403-162720425 CAGTCTTATTTTTATTAACATGG + Intergenic
965051228 3:163650882-163650904 CAGTCATTTTTTTTTTTTCTGGG - Intergenic
965116005 3:164489537-164489559 CATTTTTATTTTTAATTATTTGG + Intergenic
965432859 3:168611167-168611189 CAGTCATGTTCTAAAATACTGGG + Intergenic
966259784 3:177962573-177962595 CAGTAATATTTTTACTTTCATGG - Intergenic
966297065 3:178436317-178436339 CAGTCATATTCTGAGGTACTAGG - Intronic
966437939 3:179909659-179909681 CAGTCACAGTCTTAAATACTGGG - Intronic
966518983 3:180852634-180852656 CATTCATATTTTTAAATATATGG - Intronic
966556698 3:181269981-181270003 TAGTCATCATTTTAATTTCTAGG + Intergenic
966626889 3:182026441-182026463 CAGTCATGTATTCAATAACTAGG + Intergenic
967058297 3:185849175-185849197 CATTCAGATTTTTCTTTACTTGG + Intergenic
967224847 3:187281498-187281520 CAGTGATATTTTAAGTTTCTTGG + Intronic
967249619 3:187523413-187523435 CTGTTATATTTTCAATTTCTAGG + Intergenic
967616384 3:191573200-191573222 CAGTCATATTTTGAGATACTGGG - Intergenic
968280157 3:197471116-197471138 GAGTCACATTCTTAAGTACTGGG + Intergenic
1202749466 3_GL000221v1_random:144236-144258 CAAGCATATTTTTATTTACAAGG - Intergenic
969189761 4:5507731-5507753 CAGTGATATCTTTGATCACTTGG - Intergenic
970239230 4:13990910-13990932 CTGTCATATTTCACATTACTTGG - Intergenic
970764749 4:19534174-19534196 CAGTGATACTTTTAATAAATAGG - Intergenic
971036473 4:22698569-22698591 CACTCATATTTCTAATTTTTAGG + Intergenic
971259945 4:25047010-25047032 CAGTCACATTTTGATGTACTGGG + Intergenic
971983683 4:33791054-33791076 CATTTATATTTTTATTTCCTAGG - Intergenic
972481592 4:39502229-39502251 CAGTCATGTTGTTACTCACTAGG + Intronic
972877010 4:43374953-43374975 CAGTGATATAATTAATTCCTAGG + Intergenic
973051464 4:45603399-45603421 AAGATATATTTTTAATTCCTGGG + Intergenic
974144482 4:57930026-57930048 CAGACATATCTTTATTTATTTGG - Intergenic
974257759 4:59483687-59483709 TAGTCGTATTTTTAATTTTTAGG - Intergenic
974657532 4:64843621-64843643 CAGGCATACTTTTCAGTACTGGG + Intergenic
974745428 4:66068506-66068528 CACTCAAATTATTAATTTCTTGG - Intergenic
974819848 4:67052356-67052378 CACACATATTTTTTATGACTTGG - Intergenic
974973481 4:68860093-68860115 CAGAAGTTTTTTTAATTACTTGG + Intergenic
975050655 4:69860327-69860349 CTGTTATTTTTTTAATTATTTGG + Intergenic
975254193 4:72215163-72215185 CATTCATATTTTTTCTTCCTGGG + Intergenic
976476293 4:85486721-85486743 CAGCCATATTTTTAATGAAATGG + Intronic
976917705 4:90398283-90398305 CAGTCATATTCTAAGGTACTGGG + Intronic
977372680 4:96159931-96159953 TAGTCATATTTTTACTTATTTGG - Intergenic
977491109 4:97713012-97713034 CTGTAATATATTTAATTATTAGG - Intronic
977767601 4:100818236-100818258 CAGTAATATTAATAATTCCTAGG - Intronic
978107519 4:104921327-104921349 TCGTCATATTTTAAATTACAGGG - Intergenic
978603128 4:110449361-110449383 GATACATATTTTTAATTAATAGG - Intronic
978655176 4:111057437-111057459 CAGTTTTATTTTTAATTTTTGGG - Intergenic
978811836 4:112858217-112858239 CAGTAATATTGTCACTTACTAGG - Intronic
979399058 4:120225375-120225397 CAGTCACATTTTGAGCTACTAGG + Intergenic
979650683 4:123126913-123126935 TAGTCTTATTTTTAATTAACGGG - Intronic
980005303 4:127535300-127535322 TAGTCACATTTTGAAGTACTAGG + Intergenic
980126513 4:128779644-128779666 CAGGCACATTTATAAATACTAGG + Intergenic
980214085 4:129828639-129828661 CAGTCATATTCTGAGGTACTGGG + Intergenic
980417231 4:132507315-132507337 CATTCAGAGTTATAATTACTTGG + Intergenic
980980460 4:139650473-139650495 CAGTCATATTCTGAGGTACTGGG - Intergenic
981257900 4:142684821-142684843 CTTTCACATTATTAATTACTTGG + Intronic
981271471 4:142850981-142851003 CAGTCATATTCTGAGATACTGGG + Intergenic
981682510 4:147415881-147415903 CAGTTACATTTTGAAGTACTGGG - Intergenic
982597254 4:157402819-157402841 AAATCATGTTTCTAATTACTTGG + Intergenic
982726009 4:158907140-158907162 CAGTTTTATTTTTAATAAATTGG + Exonic
982890144 4:160837071-160837093 CAGTAATACTTTTAATTAGTGGG - Intergenic
983211382 4:164961791-164961813 CAGTCATGTATTTTTTTACTTGG - Intronic
983437678 4:167735631-167735653 CAGTCACATTTTGAAGTATTGGG - Intergenic
983443822 4:167823273-167823295 GTGTCATTTTTTTAATTAATTGG + Intergenic
983462083 4:168038415-168038437 CTGTGATATTTTTAATAACAGGG + Intergenic
983806385 4:171998524-171998546 CAGTCACATTTTTAGGTAGTGGG + Intronic
984058693 4:174964128-174964150 CAGTCACATTCTCAAGTACTGGG - Intronic
984073476 4:175146781-175146803 CAGTCAATTTTTTAACTTCTTGG + Intergenic
984336016 4:178391692-178391714 AATTCATAATTTTAACTACTTGG - Intergenic
1202752322 4_GL000008v2_random:19200-19222 CAAGCATATTTTTATTTACAAGG + Intergenic
985811324 5:2090016-2090038 CAGTCATATTTTTTTTCCCTAGG - Intergenic
985975041 5:3412125-3412147 CAGTCATATTTTTAAGTACAGGG + Intergenic
986142520 5:5044525-5044547 CAAGCATATTTTAAATTCCTAGG - Intergenic
986803111 5:11281861-11281883 CAGTCATATTCTGAGGTACTGGG + Intronic
986964062 5:13248846-13248868 AAGTCAGACTTTTAATTATTAGG - Intergenic
987256455 5:16158272-16158294 CAGTTCTATTTTTAATTTTTGGG - Intronic
987343078 5:16955645-16955667 CAGTCACATTTTGAGGTACTGGG - Intergenic
988200515 5:28063283-28063305 CAGACACATTTTTAGTCACTGGG + Intergenic
988258569 5:28852112-28852134 CAGTAATATTTTGTGTTACTGGG - Intergenic
988668491 5:33356033-33356055 CTGTCATATATTTAATTGCATGG + Intergenic
988944245 5:36179415-36179437 CTGTAATATTTTAAAATACTTGG + Intronic
990044324 5:51410417-51410439 CAGTCACATTTTTAAAGACCTGG - Intergenic
990380634 5:55219438-55219460 CAATCATATTTTACATTTCTTGG - Intergenic
990561441 5:56987496-56987518 CACTCAGATTTTCATTTACTAGG - Intergenic
990852632 5:60224408-60224430 GGGTCATATTTTTAAGAACTGGG + Intronic
991069184 5:62457749-62457771 CATTCATAATTTCAATTATTTGG - Intronic
991192553 5:63892329-63892351 CAATAATATTTTTAAATACCAGG + Intergenic
991457437 5:66819613-66819635 CAATCATATTTTAAATTCCAGGG + Intronic
991926836 5:71713987-71714009 AAGTCATATAGTTAATTTCTTGG + Intergenic
992131857 5:73701179-73701201 AAATCAGATTTTTAAATACTAGG + Intronic
992202454 5:74397766-74397788 CAGTCATATTCTGAGGTACTAGG + Intergenic
993184301 5:84596909-84596931 CAATCATTTTTTTAAGAACTTGG + Intergenic
993218688 5:85061634-85061656 CAGTCAAATTATTAATTTTTTGG + Intergenic
993311010 5:86331942-86331964 CACACATATTTTTCATTTCTTGG - Intergenic
993339064 5:86699716-86699738 CAGTCATATTTTTAACTAAGGGG + Intergenic
993385352 5:87255943-87255965 CAGTCATATTTGTATTTATTTGG - Intergenic
993630475 5:90280123-90280145 ACATCATATTTTTATTTACTAGG + Intergenic
993835972 5:92820707-92820729 CAGTCACCATTTTAATTAATAGG - Intergenic
994194981 5:96912979-96913001 CAATCATATGATTAATAACTAGG - Intronic
994889665 5:105616474-105616496 CTGTGGTTTTTTTAATTACTTGG + Intergenic
994933434 5:106219084-106219106 CTGCAATATTTTTAATTACTTGG + Intergenic
995016705 5:107318149-107318171 CAGTCACATTCTGAAATACTGGG - Intergenic
996263798 5:121509188-121509210 CAGTCACATTTTAAGATACTAGG + Intergenic
996620540 5:125496705-125496727 CAGTCATATTCTGAGGTACTGGG - Intergenic
998488483 5:142524707-142524729 CATGAATATTTATAATTACTCGG - Intergenic
998709438 5:144806251-144806273 CACTCCTATTTTGAACTACTGGG + Intergenic
998879513 5:146632100-146632122 CAGTTATATTTTGCAGTACTGGG - Intronic
998950150 5:147385568-147385590 CAGTGATATTTTAAATAAGTAGG - Exonic
999070013 5:148734602-148734624 CAATCATATTCTGAAGTACTGGG - Intergenic
1000166219 5:158651196-158651218 CAGTCACATTCTACATTACTGGG + Intergenic
1000238813 5:159389976-159389998 CAGTCATATTCTGAGGTACTGGG - Intergenic
1000466149 5:161579659-161579681 CAGTCATATGTCTAATTTGTGGG + Intronic
1000523289 5:162324065-162324087 CAGTCATATTCTGAAATACCAGG - Intergenic
1000785611 5:165539467-165539489 CAGTCACATTATGAAGTACTGGG + Intergenic
1000892760 5:166818492-166818514 TAGTAATATTTTTATTTTCTTGG - Intergenic
1001370069 5:171191008-171191030 CAGTCATATTTTTAATTACTAGG + Intronic
1003364833 6:5463269-5463291 CAATCATATTTATATGTACTAGG - Intronic
1003751954 6:9068790-9068812 CAGTCATATTTTGAGGCACTGGG + Intergenic
1003856909 6:10285833-10285855 CAGTCACATTTTGAGATACTGGG - Intergenic
1004166623 6:13262395-13262417 CAGTCATATTTTTGAGTTCCTGG - Intronic
1004393977 6:15232239-15232261 CAGTCATATTCTGAGGTACTGGG + Intergenic
1007939098 6:45760410-45760432 CAGTAATATTTTGAAATACCAGG - Intergenic
1007977197 6:46113707-46113729 CAGTCATATTCTGAGGTACTAGG - Intergenic
1008161545 6:48082538-48082560 GAGTCTTATTTTTAATCACAGGG - Intergenic
1008495577 6:52130192-52130214 TATTTATATTTTTAATTTCTGGG - Intergenic
1008604030 6:53122944-53122966 CATTCATATTTTTTATTTCTTGG - Intergenic
1009809486 6:68642041-68642063 CACTTATATTTTATATTACTTGG + Intronic
1010034296 6:71305097-71305119 CAGTAATATTTTTAGCTATTTGG - Exonic
1010376365 6:75175341-75175363 AAGTCATTTTTTTAAATAATGGG - Intronic
1010864951 6:80964883-80964905 AAGTCATATTTTTAAAAATTAGG + Intergenic
1011017619 6:82774816-82774838 CAGTCAAATTTTTAACCACTAGG - Intergenic
1011047105 6:83096709-83096731 CAGTCATTTTTCCAATTCCTAGG + Exonic
1011314250 6:86014264-86014286 CAGTCATATTCTGAGGTACTGGG - Intergenic
1011775353 6:90724344-90724366 AAGTCATTTTTTTAATAAGTGGG - Intergenic
1012405594 6:98893546-98893568 CAGTCACATTCTTAGGTACTGGG + Intronic
1013709353 6:112879613-112879635 CAGTCACATTCTAAAGTACTGGG - Intergenic
1013940167 6:115651518-115651540 CAGTCATATTCTGAGTTACTGGG + Intergenic
1014628196 6:123755770-123755792 CAGTCACATTCTAAAGTACTAGG + Intergenic
1014909366 6:127071677-127071699 AAGTAATATATTTAGTTACTTGG - Intergenic
1015188463 6:130445916-130445938 CAGTCACATTCTTAAGTACTGGG + Intergenic
1015316257 6:131820311-131820333 CAGTAATATTTTTCAGAACTAGG + Intronic
1016145391 6:140665837-140665859 CAGTCACATATTGAAGTACTAGG - Intergenic
1016147757 6:140696458-140696480 CAATCATATTTTTAACAATTAGG + Intergenic
1016759835 6:147724999-147725021 CAGTCATATTTTTTGTTGATAGG + Intronic
1017615280 6:156240675-156240697 CAGTCATATTCTGAGGTACTGGG - Intergenic
1017722831 6:157256028-157256050 CAGTCATATTGTTAACTATCAGG + Intergenic
1018697036 6:166398249-166398271 CGGTCACATTTTTAGGTACTGGG + Intergenic
1019949083 7:4356527-4356549 CAGTCATATTCTGAGGTACTGGG - Intergenic
1020775790 7:12452175-12452197 TAGTTCTATTTTTAATTATTTGG - Intergenic
1020804505 7:12772002-12772024 CTATCATATTATTTATTACTTGG + Intergenic
1020941505 7:14544669-14544691 TAGTCACATTTATAATTACATGG + Intronic
1021037893 7:15823758-15823780 AAGTCATATTTTTAAGTATCAGG - Intergenic
1022273752 7:28836088-28836110 CAATAATACTTTTAATTCCTGGG - Intergenic
1023040285 7:36167188-36167210 CAGTCACATTCTGAAGTACTGGG + Intronic
1023826025 7:44010168-44010190 CAGTGATATTTTTCCTTAATGGG + Intergenic
1024352878 7:48385009-48385031 CAGTCACATTTTGAAGTACAGGG + Intronic
1024365082 7:48510858-48510880 CAGTCACATCTTGAAATACTGGG + Intronic
1024801137 7:53080791-53080813 CTATTATATTTTTAATGACTAGG - Intergenic
1024827124 7:53403864-53403886 CAGTCATATTATAAGGTACTGGG - Intergenic
1025224094 7:57141727-57141749 CAGTCACATCATTAAGTACTAGG + Intergenic
1025923549 7:65937716-65937738 CACTCAGATTTTTAATGCCTTGG + Intronic
1026089594 7:67289037-67289059 CAGTGATATTTTTCCTTAATGGG + Intergenic
1026724690 7:72861470-72861492 CAGTGATATTTTTCCTTAATCGG - Intergenic
1027119189 7:75504348-75504370 CAGTGATATTTTTCCTTAATGGG + Intergenic
1027272637 7:76531259-76531281 CAGTGATATTTTTCCTTAATGGG - Intergenic
1027289310 7:76685998-76686020 CAGTCATATTCTAAGGTACTTGG + Intergenic
1027326088 7:77050337-77050359 CAGTGATATTTTTCCTTAATGGG - Intergenic
1027771583 7:82413978-82414000 CAGTCAAAATTTTATTTAGTTGG + Intronic
1027778647 7:82496914-82496936 TAGTCATATTTTGAGGTACTGGG + Intergenic
1027895732 7:84042074-84042096 CAGTCATATGTTTCATCACTGGG + Intronic
1028411368 7:90533806-90533828 CAGTCACATTTTGAGGTACTGGG + Intronic
1029718305 7:102345686-102345708 CAGTGATATTTTTCCTTAATGGG - Intergenic
1029754310 7:102563570-102563592 CAGTGATATTTTTCCTTAATGGG + Intronic
1029772260 7:102662657-102662679 CAGTGATATTTTTCCTTAATGGG + Intronic
1030335405 7:108320123-108320145 CACTCCAATTTTTAATTATTTGG + Intronic
1030596196 7:111541874-111541896 CACTTTTCTTTTTAATTACTTGG - Intronic
1030932292 7:115539241-115539263 CAGTCATATTCGTAGGTACTGGG + Intergenic
1031081731 7:117264979-117265001 TGGTTATATTTTTAATTTCTGGG + Intergenic
1031346446 7:120672737-120672759 CAGTCATATTTTAAAATACTGGG - Intronic
1031352065 7:120745210-120745232 AAGTCATATTTTTCTGTACTGGG + Intronic
1031472277 7:122181473-122181495 CAGTCATATGTTTAAGTCTTTGG + Intergenic
1031731500 7:125307554-125307576 CATTCATATTTATATTTTCTAGG + Intergenic
1031766698 7:125786973-125786995 CAGTCACATTCTGAAGTACTGGG + Intergenic
1031822725 7:126524794-126524816 CATTCATAATTTTAGTTTCTGGG + Intronic
1032938280 7:136759243-136759265 CATTAATATGATTAATTACTAGG + Intergenic
1033203076 7:139391373-139391395 CAGTTATATTTACAATTACTTGG + Intronic
1033867474 7:145709880-145709902 CATTCCTATTGCTAATTACTTGG - Intergenic
1033955199 7:146838951-146838973 CAGTAATATTTAAAATAACTAGG - Intronic
1033983607 7:147195927-147195949 CAGTCAAATTCTGAGTTACTGGG - Intronic
1034588257 7:152115752-152115774 AAGTAAAATTTTTAAGTACTAGG - Intronic
1035145867 7:156815415-156815437 CATTGATATTGTTAATTAGTTGG - Intronic
1036959141 8:13224970-13224992 CAGTCATTTTTTTCTTTGCTAGG + Intronic
1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG + Intergenic
1038190271 8:25313873-25313895 CAGTCATATTCTGCGTTACTAGG + Intronic
1038296554 8:26296805-26296827 CAGTCATGGATTTATTTACTTGG + Intronic
1039296262 8:36158993-36159015 CAGACATTGTTTTAAGTACTGGG + Intergenic
1039700298 8:39955075-39955097 CAGTTATATTTTTAGGTACTAGG + Intronic
1040487800 8:47890760-47890782 CATGCATATTTTTAAAAACTTGG - Intronic
1040980830 8:53244840-53244862 CAGTCACATTCTGAAGTACTGGG - Intronic
1041211363 8:55554495-55554517 CAGTCATATTCTGAGGTACTAGG - Intergenic
1041435323 8:57832606-57832628 CAGTCATATTTTGAGTTGCTGGG + Intergenic
1041448894 8:57986015-57986037 CATTCATATTCTTAATTATGTGG + Intergenic
1041715478 8:60928142-60928164 CAGTCACATTTTGAAGTACTGGG + Intergenic
1042182772 8:66108505-66108527 CAGTCACATTCTGAAGTACTAGG + Intergenic
1042367923 8:67957835-67957857 CAGTCCTATTCTTAAGTATTGGG - Intronic
1042485722 8:69343528-69343550 CTGTCATATTCTGAAGTACTGGG + Intergenic
1042919084 8:73904430-73904452 CAGTCATAATTTTGGTTATTAGG - Intergenic
1042972857 8:74429721-74429743 CAGTCATACTTTGAAGTACTGGG + Intronic
1043319224 8:78961508-78961530 AAGTGATATTTTGAAATACTAGG + Intergenic
1043512287 8:80961468-80961490 CACTCCTCTTATTAATTACTAGG - Intergenic
1043798799 8:84579656-84579678 AAGTCATTATTTTAGTTACTTGG + Intronic
1044160601 8:88909678-88909700 GAGTCCTATTTTTAATGATTAGG + Intergenic
1044282527 8:90373180-90373202 CAGCCACATTTTGAATTATTGGG - Intergenic
1044364452 8:91326574-91326596 CAGTCACATTCTGAAGTACTGGG + Intronic
1044630227 8:94271417-94271439 TATTAATATTGTTAATTACTTGG - Intergenic
1046365984 8:113233396-113233418 CAATCATGTTTTTAATTTCTAGG - Intronic
1046616724 8:116486049-116486071 CAGTCACATTTTGAAGTATTGGG - Intergenic
1047396350 8:124502766-124502788 CCCTCATATTTTTATTTACTTGG + Intronic
1047612871 8:126538250-126538272 CAGTCACATTCTGAAATACTAGG - Intergenic
1049903738 9:196084-196106 CAGTCATATTCTAAACTACTGGG - Intergenic
1050674177 9:8033294-8033316 CAGTCCCATTTTTAAATAGTTGG + Intergenic
1051082952 9:13313931-13313953 CAGTCTGTTTTTTAATTCCTGGG + Intergenic
1051925533 9:22320552-22320574 CAATCATATTTTGAGGTACTGGG - Intergenic
1051952799 9:22657481-22657503 CTGTCAAAGTTTTAATCACTAGG + Intergenic
1051963215 9:22793591-22793613 CAGGCATTTTTCTAATTACTGGG + Intergenic
1052203109 9:25806318-25806340 CAGTGATATTTTTAAATGCAGGG - Intergenic
1052459002 9:28738512-28738534 CAGTCTTATTTTTAATCAAACGG - Intergenic
1052539604 9:29792743-29792765 CACTCATATTTTTAAAAACTAGG - Intergenic
1053029278 9:34760304-34760326 CAGTCACATTTTTCTTTACAAGG - Intergenic
1053080548 9:35172558-35172580 CAGTCTTTTCTTTGATTACTGGG + Intronic
1053105978 9:35408270-35408292 AAGTCAAATTTTTTAATACTTGG - Intergenic
1053521766 9:38787634-38787656 TAGTTCTATTTTTAATTATTTGG - Intergenic
1053746743 9:41206389-41206411 CAGTCATATTCTAAACTACTGGG - Intergenic
1054193933 9:62011623-62011645 TAGTTCTATTTTTAATTATTTGG - Intergenic
1054446767 9:65376782-65376804 CACTCATATTGTTATTTTCTTGG - Intergenic
1054480540 9:65658968-65658990 CAGTCATATTCTAAACTACTGGG + Intergenic
1054644474 9:67577068-67577090 TAGTTCTATTTTTAATTATTTGG + Intergenic
1054681602 9:68224893-68224915 CAGTCATATTCTAAACTACTGGG + Intergenic
1055043822 9:71904388-71904410 CATTCTCACTTTTAATTACTAGG + Intronic
1055634749 9:78265406-78265428 CAGTCAGATTTTCAATTACTAGG + Exonic
1056515776 9:87347968-87347990 CAGTCATATTCTGAGGTACTGGG + Intergenic
1056626148 9:88255034-88255056 CAGTCATATTCTGATGTACTAGG + Intergenic
1056683576 9:88741243-88741265 CAGTCATATTCTGAGGTACTGGG - Intergenic
1057045435 9:91882642-91882664 CAGTCATATTTTGAGGTCCTGGG - Intronic
1057331877 9:94122491-94122513 CAATCACATTTTGAGTTACTGGG - Intergenic
1057530029 9:95837069-95837091 CAGTCACATTCTGAAGTACTGGG + Intergenic
1057999509 9:99850653-99850675 CAGTCCTATGTTTAATAAGTAGG + Intronic
1058134096 9:101288085-101288107 CAGTCAAAATTTTTATTCCTTGG - Intronic
1058744618 9:107977778-107977800 CAATTATATTTTTAATCATTGGG - Intergenic
1058889859 9:109352143-109352165 CAGTCATATTTTCTCTTTCTGGG + Intergenic
1059496736 9:114716239-114716261 CAGTCATATTCTGAGGTACTGGG + Intergenic
1059524518 9:114978113-114978135 AAGATATATTTTTAATGACTTGG + Intergenic
1059725869 9:117007609-117007631 CAGGCATATTTTTAGGTATTGGG - Intronic
1060626069 9:125112987-125113009 CAGTCATATATTTATGTAATTGG - Intronic
1202782873 9_KI270718v1_random:17168-17190 CAGTCATATTCTAAACTACTGGG - Intergenic
1203718107 Un_KI270742v1:174327-174349 CAAGCATATTTTTATTTACAAGG - Intergenic
1203533113 Un_KI270743v1:3901-3923 CAAGCATATTTTTATTTACAAGG + Intergenic
1186596033 X:10982548-10982570 CAGTCATATTCTAAGATACTGGG - Intergenic
1186671651 X:11773228-11773250 CAGTCATTTTTTTATCTAATAGG + Intronic
1187053162 X:15714308-15714330 CAGTCACATTTTAAGGTACTGGG + Intronic
1187553555 X:20329786-20329808 CAGAAACGTTTTTAATTACTAGG - Intergenic
1187597437 X:20788693-20788715 CAGTCACATTTTCAGGTACTGGG - Intergenic
1187892276 X:23947347-23947369 TTGTAATATTTTTAAATACTGGG + Intergenic
1188002081 X:24992353-24992375 CAGTCAGTTTTTTAATTGCATGG - Intronic
1188052626 X:25506517-25506539 CAGTCATATTCTGAGGTACTGGG + Intergenic
1188747462 X:33863805-33863827 CAATCATATTCTGAGTTACTGGG + Intergenic
1189291961 X:39892962-39892984 CACTGATTTTTTTAATTTCTAGG + Intergenic
1191806122 X:65135325-65135347 TACTCATATTTTTTGTTACTAGG + Intergenic
1193593327 X:83417474-83417496 CAGTCATTTTTTTTATTTATGGG - Intergenic
1194527573 X:94996140-94996162 CAGACATCTTTTTAACTACATGG - Intergenic
1194599186 X:95899567-95899589 CAGTCATATTTTTAGGTACTGGG + Intergenic
1194687640 X:96942804-96942826 CAGTCTTATTTATACTTAATTGG + Intronic
1194751455 X:97689201-97689223 CTGCTATATTTTTAATTTCTAGG - Intergenic
1194892063 X:99392479-99392501 CAGTGTTATTTTTGATTAGTAGG + Intergenic
1195437510 X:104862359-104862381 CAGTCACATTCTGAGTTACTGGG - Intronic
1195437941 X:104866877-104866899 CAGTCATGTTCTTAAGTAGTGGG + Intronic
1195655741 X:107329885-107329907 CAGTCACATTCTGAAGTACTGGG - Intergenic
1196505713 X:116438852-116438874 CAATCATATTTCTTATTAATTGG + Intronic
1196754922 X:119149595-119149617 TAGTCATATGGTTAATTAGTGGG - Intronic
1197069399 X:122277144-122277166 CTGACATATTTTTATTTTCTAGG + Intergenic
1197972694 X:132131857-132131879 CAGTCACATTCTGAGTTACTAGG - Intergenic
1198653242 X:138886759-138886781 GTTTCATAGTTTTAATTACTTGG + Intronic
1199055590 X:143290216-143290238 CATTCATATGTTTAATTGCATGG - Intergenic
1199419821 X:147631954-147631976 CAGTCATATTCTGAGTTGCTGGG + Intergenic
1199460733 X:148081765-148081787 CAGTCATATTTTTGGTATCTTGG - Intergenic
1199539811 X:148946405-148946427 CACTCAGAATTTTAATTATTTGG + Intronic
1200094921 X:153653627-153653649 TTGTCATATTTTTCATTTCTAGG - Intergenic
1201172265 Y:11279176-11279198 CAAGCATATTTTTATTTACAAGG - Intergenic
1201242716 Y:11974173-11974195 CAGTCATATTTTGAGTTCCTGGG + Intergenic
1201962558 Y:19698055-19698077 CACTCATATTTTCAATTCATAGG + Intergenic
1202016024 Y:20407573-20407595 GAGTTATATTTCCAATTACTAGG + Intergenic