ID: 1001370800

View in Genome Browser
Species Human (GRCh38)
Location 5:171198829-171198851
Sequence CTGAAGAAACAGGCAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1374
Summary {0: 1, 1: 0, 2: 6, 3: 145, 4: 1222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001370800_1001370802 10 Left 1001370800 5:171198829-171198851 CCTTTCTCTGCCTGTTTCTTCAG 0: 1
1: 0
2: 6
3: 145
4: 1222
Right 1001370802 5:171198862-171198884 CTCGTAGCTCCCTGTGACTTAGG 0: 1
1: 0
2: 1
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001370800 Original CRISPR CTGAAGAAACAGGCAGAGAA AGG (reversed) Intronic
900096262 1:941322-941344 CCCCAGAAACAAGCAGAGAACGG - Intronic
900459846 1:2797718-2797740 CAGAAGGAAGAGGCAGTGAAGGG + Intronic
900680125 1:3911992-3912014 CTGGAGACAAAGGAAGAGAAAGG - Intergenic
900690941 1:3980003-3980025 CTTGAGAAACAGGCACAGACAGG + Intergenic
900779796 1:4610718-4610740 GTGAAGAATGAGGCAGAGATGGG - Intergenic
901708916 1:11098889-11098911 CCCAAGAAAAAAGCAGAGAAAGG + Intronic
902117743 1:14136042-14136064 CTGAAGAATGGGGGAGAGAAAGG + Intergenic
902152121 1:14451862-14451884 CAGAACAAAAAGGCTGAGAAGGG - Intergenic
902476767 1:16692583-16692605 GCGAAGAAAAAGGAAGAGAAGGG - Intergenic
902597904 1:17521651-17521673 CGGAGGAAACAGGCACAGAGAGG + Intergenic
902880614 1:19369740-19369762 CTGAAGGGACAGGGAGTGAAGGG + Intronic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903067656 1:20709806-20709828 CTGAAGGAGCACCCAGAGAAGGG - Exonic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903679449 1:25087479-25087501 CTGGAGTCACAGGCAGAGAGAGG + Intergenic
904009564 1:27382151-27382173 ATGAGGAAATAGGCAGAGAGAGG + Intronic
904354252 1:29928377-29928399 CAGAATAAAAAGGCAGAGGAAGG - Intergenic
904730132 1:32584118-32584140 ATGAAGACAGAGGCAGAGATTGG + Intronic
905003322 1:34690623-34690645 ATGACGAAACAGGCACAGAGTGG - Intergenic
905268123 1:36769003-36769025 CTGAAGTAATAGACAGATAACGG - Intergenic
905277219 1:36826073-36826095 TGGAATAAACATGCAGAGAATGG + Intronic
905328880 1:37178025-37178047 CTGAAATAAGAGGCAAAGAAGGG - Intergenic
905737157 1:40337463-40337485 TTGAATAAAAAGGCAGAGGAAGG + Intergenic
906107684 1:43304696-43304718 CTGAAGAACCGGGCAGGGGAAGG + Intronic
906166066 1:43687308-43687330 ATGAAGAAACAGGCACCTAATGG + Intronic
906249408 1:44299954-44299976 CTGACAAACCAGGCAGAGACCGG + Intronic
906674082 1:47680756-47680778 CTGAAGACACAGGGAGAAGACGG - Intergenic
906693305 1:47807208-47807230 CTGAGTCAACAGGCAAAGAAGGG + Intronic
906808830 1:48805789-48805811 ATGAGGAAACAGGCTGAGAGAGG - Intronic
906811617 1:48832780-48832802 TAGAATAAAAAGGCAGAGAAAGG + Intronic
907256075 1:53180123-53180145 TAGAACAAACAGGCAGAGGAAGG + Intergenic
907747369 1:57226711-57226733 GTGAGGAAACAGGCTGAGAAAGG + Intronic
907824123 1:57999214-57999236 CTGTAGAACAAGCCAGAGAAGGG + Intronic
907917507 1:58884531-58884553 GTGAAGAAAGGGGCAGAGCAAGG + Intergenic
908315060 1:62924411-62924433 ATAAAGAAATAGGCAGAGAGGGG + Intergenic
908401921 1:63779470-63779492 CGGTAGAAACTGGAAGAGAAAGG + Intronic
908458252 1:64325092-64325114 ATGAAGACAGAGGCAGAGATTGG - Intergenic
908564345 1:65339228-65339250 ATGAAGGAACAGGCACTGAAAGG + Intronic
908767213 1:67564931-67564953 CTTCAGAATCAGGCAGAGAGGGG + Intergenic
909278921 1:73723797-73723819 CAGAATCAACATGCAGAGAAGGG + Intergenic
909459653 1:75895167-75895189 CTGAATCAACAGGCAAAGAAGGG + Intronic
909515653 1:76504241-76504263 GTGAAGAAGGAGGCAGAGATGGG - Intronic
909546228 1:76851321-76851343 CAGAAGAACCAGGCTCAGAAAGG + Intergenic
910141742 1:84033739-84033761 CTGAATCAACAAGCAAAGAAGGG + Intergenic
910240882 1:85085073-85085095 GTAAAGAAGCAGGCAGAGACTGG + Intronic
910310962 1:85824193-85824215 GTGAAGACAGAGGCAGAGATTGG + Intronic
910318195 1:85913611-85913633 CTGAATCAACAGCCAAAGAAGGG + Intronic
910536474 1:88303790-88303812 CTTCAGAGAAAGGCAGAGAAAGG - Intergenic
911091869 1:94023585-94023607 CTGAATACACATGCAGAGAAAGG + Intronic
911272297 1:95817343-95817365 CTGGAGAAACAAGCAAAGTAGGG + Intergenic
911472239 1:98332997-98333019 GTGAAGTTAGAGGCAGAGAATGG + Intergenic
911496894 1:98642951-98642973 CTAAACCAACAGGCAAAGAAGGG + Intergenic
911682592 1:100734612-100734634 CTGAAGAAAAAAGCGGAGACAGG + Exonic
911824556 1:102465057-102465079 GTGAAGAAAAAGGGAGAGACGGG - Intergenic
911882149 1:103253502-103253524 GTGAAGACAGAGGCAGAGATTGG + Intergenic
911986876 1:104637996-104638018 TTGAAGAAATAGGCAGATCAAGG - Intergenic
912460220 1:109825475-109825497 ATGCAGAAACAGGCAGAGAGAGG + Intergenic
912528211 1:110300544-110300566 ATGAAGGAACAGGCATAGAGAGG + Intergenic
912866460 1:113262184-113262206 GTGAAGAAAGAGGCACTGAAGGG + Intergenic
913185279 1:116365042-116365064 ATGAAGAAAGCAGCAGAGAAGGG + Intergenic
913321174 1:117589577-117589599 CAGAACAAAAAGGCAGAGAAAGG + Intergenic
913511579 1:119567426-119567448 GTAGAGAAACAGGCAGAGCATGG - Intergenic
913515816 1:119604752-119604774 GTAGAGAAACAGGCAGAGCATGG - Intergenic
913806702 1:122808853-122808875 TTGAGGAAAAAGGCAGAAAAGGG + Intergenic
913844969 1:123494066-123494088 TTGAGGAAAAAGGCAGAAAAGGG + Intergenic
914422747 1:147544082-147544104 CTGAGGATATAGGAAGAGAAAGG + Intronic
914921314 1:151849461-151849483 CTAAAGAAGCAGGGAGGGAAGGG - Intronic
914973782 1:152337432-152337454 TTCAAGAAAAAGGCAAAGAATGG - Intergenic
915419360 1:155767250-155767272 CTGTAGAATCACCCAGAGAAGGG + Intronic
915620032 1:157076073-157076095 CTGAATAAATAAGCAGGGAAGGG - Intergenic
915657259 1:157371445-157371467 CTGAAACAAAAGGCAGAGCAGGG - Intergenic
915671734 1:157494944-157494966 CTGAAACAAAAGGCAGAGCAGGG + Intergenic
916017108 1:160759945-160759967 CTGAATCAACAGGCAAAGAAGGG - Intergenic
916036980 1:160931027-160931049 ATGAAGACGGAGGCAGAGAAGGG - Intergenic
916205324 1:162310910-162310932 CTGAAGAAACAAGCGAAGATGGG - Intronic
916235098 1:162579076-162579098 CTGAATAAACAGGAAGAAAAGGG - Intronic
916288151 1:163133248-163133270 CAGAAGCAAGAGGGAGAGAAGGG - Intronic
916302278 1:163289224-163289246 ATGAACAAACAAGCAGAAAAGGG - Intronic
916352968 1:163873054-163873076 CTGATGACAGAGGCAGAGATGGG + Intergenic
916366568 1:164035557-164035579 ATTAAGGAACAGTCAGAGAAGGG - Intergenic
916622111 1:166510580-166510602 TTGAAGAAAGAGTGAGAGAAAGG + Intergenic
916622132 1:166510759-166510781 CTGAGAAAACAGGGACAGAAAGG + Intergenic
916971657 1:170026069-170026091 ATGAAGACAAAGGCAGAGACTGG + Intronic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917347206 1:174040562-174040584 ATGAGGAAACAGGCACAGAAGGG + Intergenic
918063835 1:181086079-181086101 ATGAAGAAACTGGCAGGGCATGG - Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
918503939 1:185230452-185230474 GTGAAGAAAAAGGCAGAGATGGG - Intronic
919007399 1:191915405-191915427 GTGAAGAAAAAAGCAGAGACTGG + Intergenic
919495845 1:198267103-198267125 CTGAGAATACAGGCAGAGAAAGG - Intronic
919516853 1:198535757-198535779 CTGAGGAAACAGGCACAGCAAGG + Intronic
919759986 1:201091793-201091815 CTGCAGAGGCAGGCAGGGAAGGG + Intronic
919859102 1:201727027-201727049 CTGAGGAAACAAGCAGAGGGAGG - Intronic
919929563 1:202212585-202212607 GTGAAGACAGAGGCAGAGATTGG - Intronic
919958871 1:202446169-202446191 CTGAAGAAACAAACATAGAGAGG + Intronic
920195403 1:204223193-204223215 CTCCAGAAGCAGGCAGGGAATGG - Intronic
920697374 1:208191627-208191649 ATGAAGAAACAGGCACAGAGAGG + Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921014232 1:211172812-211172834 CTCAAGAAACATGAAGACAATGG - Intergenic
921103525 1:211952455-211952477 ATAAGGAAACAGGCACAGAAAGG + Intronic
921264919 1:213414471-213414493 GTGAAGAAGGAGGCAGAGATTGG + Intergenic
921457784 1:215393176-215393198 CTGAAGAAACACCGACAGAATGG + Intergenic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921760301 1:218905990-218906012 CAGGATAAAGAGGCAGAGAATGG - Intergenic
921871473 1:220145173-220145195 ATGAAGAAACAAGCAAAGAGAGG - Intronic
921879868 1:220243890-220243912 CAGAAAACACAGGCACAGAAGGG + Intronic
921906310 1:220498797-220498819 CTGGAAAGACAGGCAGAGAAAGG - Intergenic
921968576 1:221119898-221119920 CTGAAGACACAGGGAGAAGATGG + Intergenic
922170823 1:223153095-223153117 CAGAACAAAAAGGCAGAGGAAGG - Intergenic
922256968 1:223900800-223900822 CTGAAGAAAAGGACAGTGAATGG + Intergenic
922541596 1:226424376-226424398 CTGAAGCTACAGGGAGAGCAAGG + Intergenic
922564879 1:226595276-226595298 AGGAACAAACAGGCAGAGGAAGG - Intronic
922772796 1:228196996-228197018 GTGAAGACAGAGGCAGAGACTGG - Intergenic
922863853 1:228842211-228842233 CTGAAGACAGTGACAGAGAAAGG + Intergenic
923095240 1:230770327-230770349 CAGAACAAAAAGGCAGAGGAAGG - Intronic
923149899 1:231223226-231223248 CTGAAAAAACAGGCCGAGCGTGG + Intergenic
923308552 1:232711190-232711212 CTTAAGTAAAAGGCAGTGAAAGG + Intergenic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923891411 1:238219206-238219228 GTGAAGATAGAGGCAGAGATTGG + Intergenic
923908047 1:238407864-238407886 GTGAAGAAAGAGGAAGAGACAGG + Intergenic
924228759 1:241945477-241945499 CCAAAGAAACAGGCTGACAATGG - Intergenic
924594578 1:245434410-245434432 CTGCAGAGACAGGGAGAGAAAGG - Intronic
1062802046 10:388087-388109 TTAAAGAAAAAGGCAGAGAGGGG - Intronic
1063109812 10:3025477-3025499 CAGAAGGCACAGGCACAGAAGGG - Intergenic
1063440335 10:6067780-6067802 CTGAGGAGAGTGGCAGAGAAAGG + Intergenic
1064559687 10:16583915-16583937 TTGATGAAACAGGCAGAGATTGG - Intergenic
1064574904 10:16734949-16734971 GTGAAGACACAGGGAGAAAAGGG + Intronic
1064794125 10:18992061-18992083 TTGAAGAAACAGGCAAAGAAGGG + Intergenic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1064902035 10:20305374-20305396 CTGAAGAAATAAGCAGAAACTGG + Intergenic
1065095593 10:22277825-22277847 CTGTAGAGAAAGGGAGAGAATGG + Intergenic
1065216331 10:23452318-23452340 CAGAAGAAACGGGCAGTGAGTGG + Intergenic
1065419853 10:25530952-25530974 CTGAAGGAAGAGGCACAGAATGG - Intronic
1065437315 10:25716722-25716744 CTGAAAAGACAGTCAGTGAAGGG - Intergenic
1065438203 10:25722816-25722838 CTGAAAAGACAGTCAGTGAAGGG - Intergenic
1065516092 10:26525771-26525793 CTGAAGAAACAGGAAGAAGTGGG + Intronic
1066078910 10:31909958-31909980 CTGAAGAGAGAGGCAGAAACTGG + Intronic
1066162552 10:32749118-32749140 CTGGAGAAACAGGTAAAGATAGG - Intronic
1066197398 10:33114464-33114486 CTGCAGCAACAGCCAGAGACTGG + Intergenic
1066393809 10:34999818-34999840 CTGAATCAACAGGCAAAGAAGGG + Intergenic
1067070596 10:43128302-43128324 GGGAAGAAACATGCTGAGAATGG + Exonic
1067264181 10:44722877-44722899 ATGAAGAGACAGCCAAAGAAAGG + Intergenic
1067530061 10:47064006-47064028 GTGATGACAAAGGCAGAGAATGG + Intergenic
1067555959 10:47271763-47271785 TAGAATAAACAGGCAGAGGAAGG + Intergenic
1067666352 10:48282914-48282936 CTGAATCAACAGGCAAAGATGGG - Intergenic
1067842391 10:49691406-49691428 CTGAAGAAGCAAACACAGAATGG - Intronic
1068271420 10:54730964-54730986 GTAAAGAGACAGCCAGAGAATGG + Intronic
1068517222 10:58039437-58039459 CTGAACAAGCAGGAAGATAAGGG - Intergenic
1068643478 10:59438082-59438104 CTGAATGAATAGGAAGAGAAAGG - Intergenic
1068801496 10:61145615-61145637 CAGAAGAAAAAGACAGAGTATGG - Intergenic
1068856865 10:61806577-61806599 CTGAATCAACAGGGAAAGAAGGG + Intergenic
1069139134 10:64802183-64802205 CTGAATCAACAGGTAAAGAAGGG - Intergenic
1069209716 10:65741193-65741215 CTGAATAAATAGGCAAAGAAGGG - Intergenic
1069682706 10:70296636-70296658 CTGGAGACACAGTCAGAGCACGG + Intergenic
1069770323 10:70894429-70894451 GTGAAGACAGAGGCAGAGATAGG - Intergenic
1069950343 10:72014367-72014389 CTGCAGGAAGAGGCAGAGGAGGG + Intergenic
1070271882 10:74964500-74964522 CTGAAGAAACATTTAGGGAATGG - Intronic
1070310595 10:75270844-75270866 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1070388428 10:75947840-75947862 CAGAAGAGACAGGCAGAAAGGGG - Intronic
1070535543 10:77374703-77374725 CTAAAGAAACTGCAAGAGAAGGG - Intronic
1070574212 10:77665279-77665301 CAGAGGAAACAGGGTGAGAAAGG + Intergenic
1070667483 10:78355647-78355669 ATGAGAAGACAGGCAGAGAATGG - Intergenic
1071489026 10:86123434-86123456 GTGTGGAAACAGGCAGACAAAGG + Intronic
1071671860 10:87616419-87616441 GTGAAGATACAGGCAGAGACTGG + Intergenic
1071853533 10:89599974-89599996 GTGAAGACAAAGGCAGAGACTGG + Intronic
1071969706 10:90891287-90891309 CTGAAGACAAAGGCAGAGACTGG - Intronic
1072050717 10:91700539-91700561 CTGCAGGGGCAGGCAGAGAAGGG - Intergenic
1072757873 10:98032321-98032343 CTGAAGAAACAGGTTGACATTGG - Intergenic
1072856219 10:98949840-98949862 CTGAAGAAAAAAGCAGCTAAAGG + Intronic
1073599427 10:104832347-104832369 CTGAACAAACAGGTAATGAAGGG - Intronic
1073614904 10:104983824-104983846 GTCAAGATATAGGCAGAGAATGG - Intronic
1073839011 10:107476771-107476793 CTAAAGCAACAAGCAGAGAAAGG - Intergenic
1074260240 10:111846349-111846371 TAGAAGAAAAAGGTAGAGAAAGG - Intergenic
1074306625 10:112285064-112285086 TTGAAGTCTCAGGCAGAGAATGG - Intronic
1074375628 10:112938814-112938836 CTGAAGGGACAGGGAGAGGAGGG + Intergenic
1074493071 10:113956054-113956076 CTGGAGACAGAGGCAGAGAATGG - Intergenic
1074540607 10:114362461-114362483 GTGAAGACAAAGGCAGAGACGGG + Intronic
1074600593 10:114909437-114909459 CTGAGGAAACAGTGAGAGAGAGG - Intergenic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1074863006 10:117527069-117527091 CTTAGGAAACAGACAGAGAAAGG + Intergenic
1075187329 10:120274842-120274864 GAGAACAAAAAGGCAGAGAAAGG + Intergenic
1075414874 10:122255307-122255329 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1076271540 10:129156502-129156524 CTAAATCAACAGGCAAAGAAGGG + Intergenic
1076295427 10:129380249-129380271 CTCAAGTAACAGGCACAGCAGGG - Intergenic
1076414309 10:130274342-130274364 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1077146887 11:1050450-1050472 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1077181361 11:1218661-1218683 GTGGGGAGACAGGCAGAGAAGGG + Intergenic
1077336520 11:2007339-2007361 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1077555978 11:3226293-3226315 CTGGAGAAACAAGAACAGAAAGG - Intergenic
1077812208 11:5649556-5649578 CTGAACCAACAGGCAAAGACAGG - Intergenic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1078108111 11:8371316-8371338 GTGAAGACAGAGGCAGAGACTGG + Intergenic
1078108153 11:8371666-8371688 AAGAAGAAAGAGGGAGAGAAAGG - Intergenic
1078127211 11:8579177-8579199 CTGAAGAATCAGTTAGAGTAGGG + Intronic
1079252736 11:18798839-18798861 CTGAAGAACCAGGCTTGGAAAGG + Intergenic
1079410437 11:20182505-20182527 CTGAAGACAGAGGCAGAGATGGG - Intergenic
1079422633 11:20308312-20308334 ATAAAGAAACAGACAGAGAAAGG + Intergenic
1079427374 11:20356508-20356530 GTGAAGACAGAGGCAGAGATGGG + Intergenic
1079936508 11:26623251-26623273 CTGAAAGAACTGTCAGAGAAGGG + Intronic
1080060520 11:27951800-27951822 CAGAAGTAATAGGCAGAGCATGG - Intergenic
1080328905 11:31112656-31112678 CTGAAGAAACATGTAGAAATAGG + Intronic
1080382437 11:31787517-31787539 CTGAGGGAACTGTCAGAGAAGGG - Exonic
1080566759 11:33516646-33516668 AGGAAGAAAAAGGCAGAGGAGGG - Intergenic
1080833706 11:35920113-35920135 ATGATGAAACAAGCAGAAAAAGG - Intergenic
1081877104 11:46416098-46416120 TTGGAGAAACAGGGAAAGAAAGG + Intronic
1082015709 11:47485074-47485096 ATGAGGAAACAGGCACAGAATGG - Intronic
1082644799 11:55709418-55709440 CTGAAGCAAGAGGAAGAGATGGG - Intergenic
1082820009 11:57538348-57538370 CAGAAGAAACAGGAAGAGAGAGG + Intergenic
1083121664 11:60519345-60519367 CAGAAGGGAAAGGCAGAGAAAGG + Intronic
1083136278 11:60679492-60679514 CTGAACATAGAGGCAGAGATAGG + Intergenic
1083156307 11:60825397-60825419 CTGATGACAGAGGCAGAGACTGG - Intergenic
1083188226 11:61030559-61030581 CTGAAGAAAGATGGATAGAAAGG - Intergenic
1083423791 11:62572246-62572268 GTGAAGAAACATGCTAAGAATGG - Intronic
1084046854 11:66573936-66573958 CTGAAAAGAGAGTCAGAGAAGGG - Intergenic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084180902 11:67445344-67445366 TTGAGGAAACAGGCACAGAGAGG + Intergenic
1084192811 11:67506466-67506488 CTGAAGAACCAGACCCAGAAAGG + Intergenic
1084859169 11:72006998-72007020 CTGAAGAAAAAGGCAGGGCTAGG - Intronic
1085119645 11:73958842-73958864 CAGTAGGAAGAGGCAGAGAAAGG + Intronic
1085166693 11:74407445-74407467 GTGAAGATAGAGGCAGAGATTGG - Intergenic
1085243274 11:75076045-75076067 CTGAATTAACTGGCAAAGAAGGG - Intergenic
1085466293 11:76725855-76725877 CTGAATCAACGGACAGAGAAGGG - Intergenic
1085945055 11:81259620-81259642 TAGAAGAAAAAGGCAGAGAAGGG - Intergenic
1086269546 11:85044966-85044988 ATGAATTAACGGGCAGAGAAAGG - Intronic
1086535201 11:87835901-87835923 TTGAAGAATCAGGCAAAGCAAGG - Intergenic
1086990006 11:93292378-93292400 CTGAATCAACTGGCAAAGAAGGG + Intergenic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087184152 11:95168886-95168908 AGGAAGAAGCAGGCAGAAAAGGG + Exonic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087821032 11:102712620-102712642 ATGAAGACAGAGGCAGAGATTGG - Exonic
1087854595 11:103076585-103076607 ATGAGGAAACAGGCTGAAAACGG - Intronic
1087969806 11:104465739-104465761 CAGGAGAAATAGGCACAGAAAGG + Intergenic
1088191039 11:107228427-107228449 GTGAAGAGATAGGCTGAGAAGGG - Intergenic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1088775455 11:113078234-113078256 GTGAAGACAGAGGCAGAGACTGG - Intronic
1088821719 11:113462486-113462508 GTGAAGACAGAGGCAGAGATTGG + Intronic
1089011265 11:115133694-115133716 TTGAACACAAAGGCAGAGAAAGG + Intergenic
1089771319 11:120805297-120805319 CTGAAGAACCGAGAAGAGAAGGG - Intronic
1089874634 11:121708163-121708185 CAGTAGAAGCAGGCAGAGAGAGG - Intergenic
1090279870 11:125446369-125446391 ATGAAGAAACAAGCATGGAAAGG - Intronic
1090284325 11:125486212-125486234 CTGAAGAAACAGCCATTGCATGG + Intronic
1090883425 11:130854797-130854819 CCGAAGAAAGAGACAGAGACTGG - Intergenic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1091338862 11:134795033-134795055 CCCAGGAAACAGTCAGAGAAAGG - Intergenic
1202819504 11_KI270721v1_random:62521-62543 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1091690326 12:2591898-2591920 GTGAAGACAGAGGCAGAGATTGG - Intronic
1091712813 12:2753541-2753563 CAGAAAAAAAAGGAAGAGAAGGG + Intergenic
1091998652 12:5015651-5015673 ATGAGAAAACAGGCACAGAAAGG - Intergenic
1092012219 12:5123943-5123965 CTGAATAAATAGGCAAAGAAGGG - Intergenic
1092040802 12:5382520-5382542 CTGCAGGGACAGGCAGAGAAGGG - Intergenic
1092045888 12:5431652-5431674 CTGAGGAAAAAGGCAGGAAAAGG + Intergenic
1092058912 12:5532115-5532137 CTGAAGAAACAGCCAGCCCATGG + Intronic
1092129296 12:6097525-6097547 GTGAAGACAGAGGCAGAGACTGG + Intronic
1092272607 12:7035354-7035376 CTGAATCAACAGGCAAAGAAGGG + Intronic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1092522608 12:9289906-9289928 CTGAAGAAGAGGGCACAGAAAGG + Intergenic
1092544677 12:9441991-9442013 CTGAAGAAGAGGGCACAGAAAGG - Intergenic
1092941062 12:13407637-13407659 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1093004136 12:14033914-14033936 AAGAACAAAAAGGCAGAGAAAGG + Intergenic
1093203968 12:16224457-16224479 CTGAAGAATCAGGTAGAAACAGG + Exonic
1093286163 12:17266836-17266858 GTGAAGACAAAGGCAGAGATTGG + Intergenic
1093507859 12:19889704-19889726 CTAAAAAAAAAGGCAGACAATGG + Intergenic
1093707393 12:22289330-22289352 CTGAGGAAACAGGCTTAGAGCGG + Intronic
1093761964 12:22920904-22920926 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1094216042 12:27943854-27943876 CTGAAGAAAGAGGGTGTGAATGG + Intergenic
1094461426 12:30700582-30700604 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1094508272 12:31080081-31080103 CTGAAGAACAGGGCACAGAAAGG + Intronic
1094674560 12:32606569-32606591 CTGAAGAAAAAGACAGACTAGGG - Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095239007 12:39834703-39834725 CAGAAGACAGAGGCAGATAAGGG - Intronic
1095267210 12:40174436-40174458 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1095514964 12:42995362-42995384 CTGGAGAAGAATGCAGAGAAGGG + Intergenic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1096026340 12:48366381-48366403 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1096735238 12:53648130-53648152 CTGAATCAACAGCCAAAGAAGGG + Intronic
1096793441 12:54059546-54059568 CAGAAAAAGCAGGCTGAGAAGGG - Intergenic
1097226817 12:57481823-57481845 TTTAAGGAACAGGCAGAGGAAGG - Intronic
1097314211 12:58154831-58154853 CTGAAATAACAAACAGAGAAAGG - Intergenic
1097469089 12:59966443-59966465 AAGAAGAAAGAGGAAGAGAAAGG - Intergenic
1097954037 12:65464899-65464921 ATGAAGAAATAGGCACAGAGAGG - Exonic
1098173177 12:67766894-67766916 CTGAAAAAAGAGTCAGAGAAGGG + Intergenic
1098173942 12:67771984-67772006 CTGAAAAAAGAGTCAGCGAAGGG + Intergenic
1098550542 12:71756249-71756271 CAGAAGAAACAGGCACAGACAGG - Intronic
1098605639 12:72386772-72386794 CTCAAGATAAAGGCTGAGAATGG - Intronic
1098938001 12:76502433-76502455 CTGAATCAGCAGGCAAAGAAGGG + Intronic
1098984989 12:77002490-77002512 GTGATGACACAGGCAGAGACTGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1099947213 12:89258367-89258389 ATGAAGACACAGGAAGAAAATGG + Intergenic
1100383522 12:94084474-94084496 GTGAAGATAAAGGCAGAGATTGG - Intergenic
1100772343 12:97937286-97937308 GTGAAGACAGAGGCAGAGATCGG - Intergenic
1101069026 12:101053582-101053604 GTGAAGACAGAGGCAGAGATAGG - Intronic
1101071491 12:101080591-101080613 CTGAAGACACAGGGAGAAGATGG - Intronic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1101314729 12:103618702-103618724 ATGAGGAAACAGGCACAGAGTGG - Intronic
1101541138 12:105666548-105666570 ATGAGGAAACAGACATAGAAAGG + Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102348112 12:112172496-112172518 CTGACGAAACAGGGAGGGCAAGG - Intronic
1102570555 12:113824736-113824758 TTGAAGAAACAGGCTCAGAGAGG - Intronic
1102692712 12:114773907-114773929 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1102697178 12:114809071-114809093 GGGAAAAAATAGGCAGAGAAGGG - Intergenic
1103305145 12:119958257-119958279 TTGAAGTGACAAGCAGAGAAGGG - Intergenic
1103456699 12:121072952-121072974 GTGATGACACAGGCAGAGATTGG - Intergenic
1103895643 12:124271348-124271370 ATGAAGACAGAGGCAGAGATTGG - Intronic
1104056087 12:125231173-125231195 GTGAAGACAGAGGCAGAGACAGG - Intronic
1104074885 12:125380269-125380291 GTGAAGACAGAGGCAGAGACTGG - Intronic
1104381904 12:128314680-128314702 GTGAAGAAAGGGGCAGAGATTGG + Intronic
1104388995 12:128375472-128375494 CTGAAGGAGGTGGCAGAGAAGGG - Intronic
1104433248 12:128733921-128733943 GTGAAGATAGAGGCAGAGACTGG + Intergenic
1104439174 12:128781222-128781244 GTGAAGACAGAGGCAGAGATGGG + Intergenic
1104531701 12:129578011-129578033 CAGAAGAAAAAGGCAGACGAAGG + Intronic
1105236947 13:18565549-18565571 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
1105621900 13:22076103-22076125 CTCAAGAAAAAAGCAGAGGATGG + Intergenic
1105634965 13:22208078-22208100 GGGAAGGAACAGGCAGAGCAGGG - Intergenic
1105827934 13:24139166-24139188 GTGAAGACAGAGGCAGAGACTGG - Intronic
1106193472 13:27474139-27474161 ATGAAGAAACAGGCCCAGACAGG + Intergenic
1106433671 13:29705647-29705669 CTGAAGAAGGAAGCAGAGACTGG + Intergenic
1106692083 13:32129039-32129061 ATGAAGACACAGGGAGAAAATGG - Intronic
1107015604 13:35706103-35706125 CTAAAGACACAGGAGGAGAAAGG + Intergenic
1107313245 13:39103225-39103247 GTGAAGAAAAAGGCAGAGAGTGG - Intergenic
1107350952 13:39514246-39514268 ATGAATTAACAAGCAGAGAAGGG + Intronic
1107390769 13:39961264-39961286 CTGAAGAATGTGTCAGAGAAGGG + Intergenic
1107516920 13:41138302-41138324 ATGAAGAGACATGCAGAGCAAGG - Intergenic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1107708550 13:43130918-43130940 CTGAGGAAAGAGGCTGAGCAGGG + Intergenic
1107888927 13:44897021-44897043 GTGAAGACACAGGCAGAGATTGG - Intergenic
1108067558 13:46593765-46593787 CAGAAGAAACTGACAGAGATTGG - Intronic
1108080942 13:46734996-46735018 CTGAAAAAAGAGGGAAAGAAAGG - Intronic
1108207287 13:48103155-48103177 GTGAAGACAGAGGCAGAGACTGG + Intergenic
1108701228 13:52945967-52945989 GTGAAGATGGAGGCAGAGAATGG - Intergenic
1109041790 13:57347834-57347856 TTGAACAAAAAGGCAGAGATGGG - Intergenic
1109288826 13:60447716-60447738 TAGTAGAAACAGTCAGAGAAGGG - Intronic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1109470084 13:62792386-62792408 GTGAAGACAGAGGCAGAGACTGG + Intergenic
1110242364 13:73283305-73283327 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1110394110 13:75010036-75010058 GTGAAGACAGAGGCAGAGACAGG + Intergenic
1110408908 13:75182988-75183010 GGGAAGAAACAGGGAGAGAAGGG - Intergenic
1110525510 13:76531990-76532012 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1111391176 13:87596798-87596820 CTGAATCAACAGGCAAATAAAGG + Intergenic
1111464074 13:88585284-88585306 CTGAAAAAACAGGCAAAAAAAGG + Intergenic
1111607631 13:90561470-90561492 CTGAAGACAGAGGCAGAGACTGG + Intergenic
1111685078 13:91491730-91491752 GTGAAGACAGAGGCAGAGACTGG - Intronic
1111835789 13:93386881-93386903 GTGAAGACAGAGGCAGAGATTGG - Intronic
1111941020 13:94606933-94606955 ATGAGCAAACTGGCAGAGAAAGG - Intronic
1112201892 13:97284376-97284398 CTGAAGAGGCAGGTAGAGATTGG - Intronic
1112237870 13:97652505-97652527 CTGAAAAGACAGTCAGCGAAGGG + Intergenic
1112249131 13:97762757-97762779 TGGAACAAAAAGGCAGAGAAAGG - Intergenic
1112521004 13:100095126-100095148 GTGAAGACAGAGGCAGAGACTGG - Intronic
1112669212 13:101615153-101615175 GTGAAGAGAGAGGCAGAGCAGGG - Intronic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1113017110 13:105840268-105840290 CTGAGGACACAGCCAGAGGAGGG + Intergenic
1113077120 13:106477948-106477970 GTGAAGACACAGGGAGAGGACGG - Intergenic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1114201900 14:20529005-20529027 GTGAGGAAGCAGGCAGAAAACGG + Intergenic
1114630637 14:24157414-24157436 CTGAGCAAACAGGCCGAGTAGGG - Intronic
1114720186 14:24873390-24873412 CTGAAGAAAGACTCAAAGAAAGG + Intronic
1114916737 14:27276849-27276871 CTGTTGATACAGGCAAAGAATGG + Intergenic
1115149705 14:30270419-30270441 CTTAAGATACAGGCACAGGAAGG + Intergenic
1115620977 14:35139942-35139964 ATGAAGACAGACGCAGAGAATGG - Intronic
1115631812 14:35252941-35252963 CTGAAGATATGGGCACAGAAAGG - Intronic
1116059596 14:39905130-39905152 TTGAAGAAACAAGCTGAAAATGG - Intergenic
1116082301 14:40190168-40190190 GTGAAGACACAGGGAGAAAATGG - Intergenic
1116430616 14:44841550-44841572 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
1116505857 14:45680419-45680441 CTGGAGAAAAAGACAGAAAAAGG + Intergenic
1116967428 14:51029224-51029246 CTGAAGTTACAGGCACAGGATGG + Intronic
1117075021 14:52093602-52093624 GAGAAGAAAAAGGCAGAGGAAGG - Intergenic
1117531184 14:56661891-56661913 GGGGAGAAAGAGGCAGAGAATGG + Intronic
1117642320 14:57813063-57813085 ATGAGGAAACAGGCACAGAGAGG + Intronic
1118006979 14:61572127-61572149 CTGAAGAAATATGCTGACAATGG - Intronic
1118046706 14:61978025-61978047 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1118878525 14:69805978-69806000 TTGAAGAAACAATCAGAGGATGG + Intergenic
1119016509 14:71061885-71061907 CTGAAGAACAGGCCAGAGAAAGG + Intronic
1119360492 14:74045036-74045058 CTGAGGAAACAGAAACAGAAAGG - Intronic
1119963774 14:78889975-78889997 GTGAAGACAGAGGCAGAGATTGG + Intronic
1119971791 14:78979047-78979069 TAGAAGAAAAAGGCAGAGGAAGG - Intronic
1120096729 14:80397577-80397599 CTAAAGCAATAGTCAGAGAAGGG + Intergenic
1120287802 14:82526789-82526811 GTGAAGAGAGAGGCAGAGATGGG - Intergenic
1120421570 14:84292624-84292646 ATGAAGACACAGGCAGAGACTGG - Intergenic
1120818985 14:88894582-88894604 CTGATGACAGAGGCAGAGACTGG - Intergenic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1121169987 14:91845592-91845614 CTCAAGTAAAAGGCAGGGAATGG + Intronic
1121223297 14:92302578-92302600 CTGACGAACCAGACAGAGCAGGG + Intergenic
1121403417 14:93702888-93702910 GTGAAGAAGGAGGCAGGGAATGG - Intronic
1122166349 14:99827253-99827275 CTGAAGACACAGGGAGAAGATGG + Intronic
1122242261 14:100376599-100376621 CTGAAGGAACAGGAAGTGAAAGG - Exonic
1122622356 14:103066664-103066686 CTGAACCAACAGGCAGAGAAGGG + Intergenic
1122754062 14:103963587-103963609 ATTAATCAACAGGCAGAGAAAGG - Intronic
1123088766 14:105732107-105732129 CTGAAGAGACGGGCAGAGGGAGG - Intergenic
1123457883 15:20442643-20442665 GTGAAGACGCAGGCAGAGACTGG + Intergenic
1123660186 15:22557766-22557788 GTGAAGACGCAGGCAGAGACTGG - Intergenic
1124095881 15:26648525-26648547 CCGAAGAAAGGGGCAGAGAAAGG + Intronic
1124264031 15:28217796-28217818 GTGAAGACGCAGGCAGAGACTGG + Intronic
1124314045 15:28652261-28652283 GTGAAGACGCAGGCAGAGACTGG - Intergenic
1124468746 15:29964467-29964489 GTGAAGACAGAAGCAGAGAATGG + Intronic
1124533204 15:30523650-30523672 CTGAGGAAACAGGCCAAAAAGGG + Intergenic
1124796525 15:32786470-32786492 CAGAAGAAAAAGTCAGAAAAGGG + Intronic
1124840183 15:33234352-33234374 CAGAAGAAACAGGCAAAGAAAGG + Intergenic
1124883782 15:33665274-33665296 CTAAAGAAACAGATACAGAAAGG - Intronic
1125190093 15:36981817-36981839 CAGAATGAAAAGGCAGAGAATGG + Intronic
1125421054 15:39504437-39504459 AGGAAGAAACAGGCACACAAAGG + Intergenic
1125427300 15:39562141-39562163 TAGAATAAAAAGGCAGAGAAAGG + Intergenic
1126145929 15:45472924-45472946 CTGAAGAAAAAGGCTTAGAGAGG + Intergenic
1126166702 15:45659626-45659648 GTGAAGATGGAGGCAGAGAAAGG - Intronic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126465498 15:48957886-48957908 GTGAAGACAGAGGCAGAGATTGG + Intronic
1126499714 15:49332029-49332051 ATGAGGAAACAGGCTGAGATAGG + Intronic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127352911 15:58170691-58170713 CTGAAGAAATAGGCAGGGCATGG - Intronic
1127380285 15:58425060-58425082 GGGAATAAACAGGCAGAGATAGG + Intronic
1127462580 15:59212857-59212879 GTGAAGACACAGGCAGAGACTGG + Intronic
1127489832 15:59452107-59452129 CTGAAGAATCAGGAAGAGATGGG - Intronic
1127715564 15:61645833-61645855 ATGAAGACAGAGGCAGAGACTGG + Intergenic
1127836274 15:62793621-62793643 ATGAAGAAACATTCAGAGTATGG - Intronic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128323932 15:66711400-66711422 CTGAGGAAACAGGCTCAGAGAGG + Intronic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128643036 15:69353909-69353931 CTGAATCAACAGGCTAAGAAGGG + Intronic
1128761021 15:70216078-70216100 TTGAAGAAACAGGCCCAGAGAGG + Intergenic
1129002863 15:72348314-72348336 CTGTTGACACAGGCTGAGAAAGG + Intronic
1129164070 15:73765715-73765737 CTGAGGAAGATGGCAGAGAAAGG - Intergenic
1129638441 15:77348577-77348599 TTGAAAAAGCAGGCAGAAAAAGG + Intronic
1130013097 15:80167344-80167366 GTGAAGACAGAGGCAGAGACTGG - Intronic
1130241384 15:82196128-82196150 CAGAAGAAGCAGACAGTGAAGGG + Intronic
1130920588 15:88340919-88340941 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
1131148960 15:90035065-90035087 GTGAAGGACCAGGCAGAGAAGGG + Intronic
1131254316 15:90851967-90851989 GTGAGGAAACAGGCACAGAGTGG - Intergenic
1131284332 15:91044602-91044624 CTGAAGACAGAGGCAGAGGTGGG - Intergenic
1131499882 15:92952139-92952161 TTGAAGAAACAGCCAGAGTTAGG - Intronic
1131557656 15:93413735-93413757 CAGAAGTCACAGGCAGAGAAAGG - Intergenic
1131561762 15:93449807-93449829 CAGAACAAAGAGGCAGAGGATGG - Intergenic
1131662694 15:94535498-94535520 CTGAATCAACAGGCAAAGCAGGG - Intergenic
1131671830 15:94627938-94627960 CAGAAGAAAGAGGGAGAAAACGG - Intergenic
1132013815 15:98298840-98298862 TAGAAGAAAAAAGCAGAGAAAGG + Intergenic
1132020180 15:98354212-98354234 CCGAAGAAACTGAAAGAGAATGG + Intergenic
1132249624 15:100325446-100325468 GTGAAGACACAGGGAGAGGACGG + Intronic
1132285266 15:100658014-100658036 CTGAGGAAGTGGGCAGAGAAGGG - Intergenic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1132387101 15:101408424-101408446 CTGCAGACACCCGCAGAGAATGG - Intronic
1132561933 16:599233-599255 CTGGTGGCACAGGCAGAGAAGGG - Intronic
1132659552 16:1055292-1055314 CTGAAGAATCAGGCGGAGCACGG - Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133334464 16:4997834-4997856 GTGAAGAGAGAGGCAGAGACTGG - Intronic
1133678692 16:8099832-8099854 CTGAAGAGAGAGAGAGAGAAGGG - Intergenic
1133791792 16:9014711-9014733 CTGAAGAAAGAAGAGGAGAATGG - Intergenic
1133862879 16:9612922-9612944 GTGAAGATAGAGGCAGAGATGGG - Intergenic
1133922090 16:10162547-10162569 GTGAAGACACAGGGAGAGGATGG - Intronic
1133937301 16:10279710-10279732 GCGCAGAAAAAGGCAGAGAAGGG - Intergenic
1133984059 16:10654556-10654578 CAGAACAAAAAGGCAGAGGAAGG + Intronic
1134034639 16:11020444-11020466 CTGGAGAAGCAGGGAAAGAAAGG - Intronic
1134080665 16:11322951-11322973 GTGAAGAGACAGGCACAGAGAGG + Intronic
1134142294 16:11731242-11731264 AAAAAGAAACAGGCAGACAAAGG + Intronic
1134217848 16:12330239-12330261 GTGAGGAAACAGGCACAGAGAGG - Intronic
1134372258 16:13636537-13636559 GTGAAGACAGAGGCAGAGATGGG - Intergenic
1134572425 16:15302668-15302690 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1134729957 16:16453373-16453395 GTGAAGAAACAGGCTCAGAGAGG + Intergenic
1134937476 16:18258527-18258549 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1135626320 16:23998088-23998110 CAGAACAAAAAGGCAGAGGAAGG + Intronic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1135647336 16:24174630-24174652 CTGAAGAAAGAGGCAGGGCAGGG - Intronic
1136071277 16:27788841-27788863 ATGAGGAAACAGGCACAGAAAGG + Exonic
1136372370 16:29844468-29844490 GTGAACAAACAGGCCCAGAATGG - Intronic
1137400043 16:48145967-48145989 GTGAGGAAACAGGCACAGAGAGG - Intronic
1137726509 16:50660284-50660306 GTGAAGACAGAGGCAGAGACAGG + Intergenic
1138075727 16:54040728-54040750 GTGGAGAAACAGGAAGAGAGTGG + Intronic
1138107263 16:54294806-54294828 CTGAAGACAGAGGCAAAGATTGG + Intergenic
1138304867 16:55965365-55965387 ATGAAGACAGAGGCAGAGATCGG - Intergenic
1138912201 16:61414701-61414723 GTGAAAAAAGAGGCAGGGAATGG + Intergenic
1139055007 16:63172561-63172583 CATAAGATAAAGGCAGAGAATGG + Intergenic
1139084779 16:63571582-63571604 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1139254468 16:65527876-65527898 CTGAAGAAAAATGAAGAGGAAGG + Intergenic
1139387278 16:66580748-66580770 ATGAGGAAACAGGCTGGGAATGG - Intronic
1139583554 16:67886776-67886798 CTGAGGTGACAGGCAGAGAGAGG - Intronic
1139694488 16:68664034-68664056 CTGAGGAAACAGGCCCAGAGAGG + Intronic
1139779125 16:69336186-69336208 CTGAAGAAAAAAACAGGGAATGG - Intronic
1140018666 16:71215197-71215219 CTGAAGAAGCAAGGAAAGAAGGG + Intronic
1140174972 16:72649452-72649474 CTGAATCAACAGGCAAAGAAAGG + Intergenic
1140232188 16:73126455-73126477 CTGAAGAAACAGAAACAGATGGG + Intergenic
1140878272 16:79173431-79173453 GTGAGCAAACAGGCAGAGACTGG + Intronic
1140978114 16:80080288-80080310 ATGAAGTATTAGGCAGAGAATGG + Intergenic
1141019310 16:80480020-80480042 GTGAAGACAGAGGCAGAGATGGG + Intergenic
1141294995 16:82759248-82759270 GTGAAAAATGAGGCAGAGAAGGG - Intronic
1141594123 16:85087130-85087152 CTGAAGAAGCAGGCTGTGATTGG + Exonic
1141716447 16:85729765-85729787 GTGAAGACAGAGGCAGAGACTGG + Intronic
1141725073 16:85782596-85782618 TTGAAGAAACAGTCATGGAAGGG - Intronic
1141865510 16:86747293-86747315 CTGAAAAGAGAGTCAGAGAAGGG + Intergenic
1141897306 16:86966287-86966309 GTGAAGACAGAGGCAGAGACAGG - Intergenic
1141973890 16:87501160-87501182 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1142256965 16:89018709-89018731 TTTAAGGAGCAGGCAGAGAATGG + Intergenic
1142683986 17:1566723-1566745 CAGGAGAAACAGGAAGAGAGAGG - Intergenic
1142897958 17:2994447-2994469 GTGAGGAGACAGCCAGAGAAGGG + Intronic
1143618892 17:8069881-8069903 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1144145474 17:12393689-12393711 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1144319594 17:14101303-14101325 ATGAAGAGAAAGGAAGAGAATGG - Intronic
1144377199 17:14656241-14656263 TTGAAAAATCAGGGAGAGAAAGG - Intergenic
1144642096 17:16943297-16943319 GTGAAGACAGAGGCAGAGATGGG + Intronic
1145193982 17:20870337-20870359 ATGAAAAAACAGGCAGGGAGCGG - Intronic
1145259004 17:21343714-21343736 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1145277249 17:21439421-21439443 CCCAAGAGACAGGCAGGGAAAGG - Intergenic
1145315085 17:21725315-21725337 CCCAAGAGACAGGCAGGGAAAGG - Intergenic
1145317617 17:21744290-21744312 CTGGGGAAACAGGCACAGAGAGG - Intergenic
1145375444 17:22343421-22343443 CTGAAGAAACAGGGTGAGGGGGG - Intergenic
1145713520 17:26997252-26997274 CCCAAGAGACAGGCAGGGAAAGG - Intergenic
1145933860 17:28703868-28703890 CTGAAGAAAAAAGCCAAGAAAGG - Exonic
1146596737 17:34175975-34175997 CTGGAGAAACAGGCAAAAACAGG + Intergenic
1146840864 17:36153262-36153284 CTGGAGAATCATGCACAGAAAGG - Intergenic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1148218004 17:45844516-45844538 CTAAAGAAACAGGCCTAGAGAGG + Intergenic
1148477468 17:47938471-47938493 CTGAACAAGCAGGCAGGGATAGG - Intergenic
1148896465 17:50841955-50841977 ATGAAAAAGCAGGCAGGGAAGGG + Exonic
1149293760 17:55242011-55242033 GTGAAGAAACAGGAAGAAGATGG - Intergenic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1149880570 17:60286413-60286435 GTGAAGACAGAGGCAAAGAATGG + Intronic
1150453202 17:65286793-65286815 CTGAAGAAACATGCTCAGAGAGG + Intergenic
1150583685 17:66498462-66498484 GGGAAGAAAAAGGAAGAGAAGGG - Intronic
1150593635 17:66584702-66584724 GTGAAGACATTGGCAGAGAATGG - Intronic
1151027421 17:70694930-70694952 ATGGAGAAACAGGCAGTGATTGG - Intergenic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151305647 17:73261302-73261324 CAGAAGAGAGAGACAGAGAAGGG + Intronic
1151561005 17:74869521-74869543 GTGAACAAAGAGGAAGAGAATGG - Intronic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1151881427 17:76897502-76897524 GTGACGAAGCAGGCAGAGAGCGG - Intronic
1151953759 17:77370335-77370357 GTGAAGACAGAGGCAGAGACCGG - Intronic
1152004672 17:77672618-77672640 GTGAAGACACAGGCAGAGGGTGG + Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152131915 17:78482690-78482712 TGGAAGAAAAAGGCAGACAAGGG - Intronic
1152223871 17:79083738-79083760 CTGAAGAAAAGGGCAGAACAGGG - Intronic
1152418952 17:80181705-80181727 CTGAAGACAGAGGCAGACAGTGG - Intronic
1152449191 17:80365686-80365708 CTGAAGGAAAAGGCGGAGAGAGG + Intronic
1152742004 17:82022568-82022590 CTGCAGAAACAGGCAGGGGTGGG - Intronic
1203175990 17_KI270729v1_random:13448-13470 CTGAATAAACTGGAAGGGAATGG - Intergenic
1153049335 18:886326-886348 TTGAAACAACAGGCAAAGAAAGG + Intergenic
1153142611 18:1991860-1991882 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1155317212 18:24583990-24584012 CCGGAGAAAAAGGAAGAGAAAGG - Intergenic
1155461353 18:26088146-26088168 CTGAATAAACAAGCCCAGAAGGG + Intronic
1155678970 18:28466250-28466272 CTGAACAAAAAGTCAGAGAAAGG + Intergenic
1155733056 18:29185689-29185711 CTGAATCAAAAGGCAAAGAAGGG - Intergenic
1156510987 18:37636620-37636642 CACAAGAGACAGACAGAGAATGG - Intergenic
1156561340 18:38129114-38129136 AAGAAGAAAGAGGCAAAGAATGG + Intergenic
1156584113 18:38412974-38412996 TTCAAGAAACAAGCAGAGAAAGG + Intergenic
1156864144 18:41869692-41869714 CTGACCAAAAAGGCAAAGAATGG - Intergenic
1156969337 18:43136088-43136110 CTGAAGAGCCATGCAAAGAAAGG + Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1157192306 18:45591782-45591804 ATGAAGACACATGCAGAAAAAGG + Intronic
1157335098 18:46732267-46732289 CTGAGGAAACAGGCATAGAGTGG + Intronic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1157888057 18:51388009-51388031 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1158547772 18:58410590-58410612 CTGAATAAACAGTCAGACACTGG + Intergenic
1158570228 18:58591842-58591864 CCAAAGCAACAGGCAGAGACTGG + Intronic
1158828389 18:61250762-61250784 CTGTAGAAACAAGCAATGAAGGG - Intergenic
1158881514 18:61783601-61783623 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1158899983 18:61953570-61953592 CAGAAGAGACAGGCAGGGAAGGG - Intergenic
1158959496 18:62577342-62577364 CTGAAGCAACAGGCTAAAAAAGG - Exonic
1159340134 18:67124125-67124147 CTGAGTCAACAGGCAGAGAATGG + Intergenic
1159375653 18:67589191-67589213 TTTAAAAAACAGGAAGAGAAAGG - Intergenic
1159469827 18:68837618-68837640 GTGAAGACACAGGGAGAAAACGG - Intronic
1159566966 18:70062298-70062320 AAGAAGATACATGCAGAGAAGGG + Intronic
1159598836 18:70409498-70409520 TTGAGGAAACAGGCACAGAGAGG + Intergenic
1159663334 18:71126384-71126406 ATGAAGCAAGAGGCACAGAAAGG + Intergenic
1159820267 18:73132232-73132254 CTGAAGACACAGGGAGAAGATGG + Intergenic
1160210536 18:76874584-76874606 CAGAAAAATCAAGCAGAGAAGGG + Intronic
1160487248 18:79304883-79304905 ATCAACAAACAGGCAGAAAAAGG - Intronic
1160578912 18:79872741-79872763 GTGAGGAAACAGGCTCAGAATGG - Intronic
1160928810 19:1560111-1560133 GTGAAGAAACAGGCATAGCAAGG - Intronic
1161346539 19:3771249-3771271 GTGAAGGAGGAGGCAGAGAATGG - Intronic
1161762590 19:6185362-6185384 CTGAAGATCCAGGCAGAGCTGGG + Intronic
1162498641 19:11038245-11038267 ATGAAGACAGAGGCAGAGATGGG - Intronic
1162851704 19:13436123-13436145 CTGAAGAAACAGGCAAAGGCAGG - Intronic
1163091624 19:15023908-15023930 TTGAGGAAACAGGCACAGAGAGG + Intergenic
1163203910 19:15788380-15788402 GTGAAGAGAGAGGCAGAGATTGG - Intergenic
1163410051 19:17148539-17148561 CTGAAGACAGAGGCAGAGATGGG - Intronic
1163606502 19:18278756-18278778 ATGAAGAAACTTGGAGAGAATGG - Intergenic
1163721582 19:18900450-18900472 CTGGAGACACAGGCAGACACGGG + Intronic
1164787911 19:30950585-30950607 CTCAATTAAAAGGCAGAGAAAGG - Intergenic
1164840799 19:31390730-31390752 ATGAATACACAGGCAGAGACTGG - Intergenic
1164971916 19:32539873-32539895 ATGAAGAGTCAGGCAGAGAGAGG + Intergenic
1165217152 19:34283582-34283604 ATGATGAGACAGGCAGAGAGAGG + Intronic
1166226868 19:41401404-41401426 ATGAAGAAATAGTCAGGGAAAGG + Intronic
1166575512 19:43833779-43833801 CTTAAGAAATAGGTAAAGAAGGG - Intronic
1166680571 19:44763891-44763913 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167681821 19:50928008-50928030 GTGAAGAGAGAGGCAGAGATTGG - Intergenic
1167724495 19:51201121-51201143 GGGAAGACACAGGGAGAGAAGGG + Intergenic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1167783877 19:51620303-51620325 CAGAAGAAACAGGAGGAAAAAGG + Intronic
1167805546 19:51781347-51781369 CTGAATCAGCAGGCAAAGAAGGG + Intronic
1167831963 19:52030971-52030993 ATGAAGAAAAAGGAACAGAAAGG + Intergenic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168724164 19:58571539-58571561 ATGAGGAAACAGGCAAAGAAAGG + Intronic
1202710782 1_KI270714v1_random:18407-18429 GCGAAGAAAAAGGAAGAGAAGGG - Intergenic
925583373 2:5437516-5437538 CTGAGGAGTCTGGCAGAGAATGG - Intergenic
925702234 2:6650402-6650424 ATGAAAAAAGAGGCTGAGAAGGG + Intergenic
925740826 2:7004645-7004667 CTGGGGAAAAAGGCAGAAAAAGG - Intronic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
925898713 2:8493534-8493556 CTGAACAAACAGGCTGATGAAGG + Intergenic
925961521 2:9021638-9021660 TAGAAGAAAAAGGCAGAGGAAGG - Intergenic
926006812 2:9378951-9378973 CTGGATAAACAGACAGGGAAAGG + Exonic
926230952 2:11003473-11003495 GTGAAGACAAAGGCAGAGATTGG + Intergenic
926402610 2:12513576-12513598 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
926976417 2:18520890-18520912 CTGAAGACACTGGAGGAGAAAGG - Intergenic
927475915 2:23414119-23414141 CAGAAGAAAGAGGCTGAGGAGGG + Intronic
927763087 2:25778321-25778343 GTGAAGACAGAGGCAGAGACTGG + Intronic
927983586 2:27391695-27391717 CTGTAGAAACAGGCAGTCAGAGG - Intronic
928243179 2:29604359-29604381 CAGAAAAAAGAAGCAGAGAAGGG + Intronic
928323917 2:30304908-30304930 TAGAACAAAAAGGCAGAGAAGGG + Intronic
928428338 2:31197780-31197802 GTGAAGATGGAGGCAGAGAATGG + Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
928650655 2:33400367-33400389 GTGAAGACACAGGGAGACAATGG + Intergenic
928697706 2:33866749-33866771 ATGAGGAAACAGGCATACAAAGG + Intergenic
928789213 2:34931382-34931404 TGGAAGACAGAGGCAGAGAAGGG + Intergenic
929046770 2:37798192-37798214 GTGGAGAAACAGGCACAGACAGG - Intergenic
929854844 2:45628130-45628152 TTGAAGACAGAGGCAGAGAGTGG - Intergenic
930166183 2:48205825-48205847 CGGAAGGAACAGGAGGAGAAGGG + Intergenic
930358666 2:50350513-50350535 CTTAGCAAACACGCAGAGAATGG - Intronic
930513642 2:52378669-52378691 CAGTAGAAAAAGGCAAAGAAGGG - Intergenic
930852577 2:55976318-55976340 ATGAAGAAAAAGCCAGATAAGGG + Intergenic
930880352 2:56263468-56263490 CTGAGCAGACAGGCAGAGAAGGG - Intronic
930995237 2:57708989-57709011 AGGAAGAGACAGGGAGAGAAAGG + Intergenic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931917271 2:66969800-66969822 ATGAACAAAGAGGCAGATAAGGG - Intergenic
931961504 2:67488129-67488151 CTGAAGATAGAGGCAGAAATTGG + Intergenic
932107334 2:68956764-68956786 GTGAAGAAAGAGCAAGAGAAAGG - Intergenic
932209091 2:69913067-69913089 CTGAAGAAAAAGAAAGACAAAGG - Intronic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
932827378 2:74954309-74954331 CAGAAGAAACAGGAAGACGAAGG - Intergenic
932893690 2:75618112-75618134 CTGAAACAACAGGGAGGGAAAGG + Intergenic
932901093 2:75700920-75700942 GTGAAGACAGAGGCAGAGAGAGG + Intronic
933588975 2:84210668-84210690 ATGAAGAAACAGGCACAGAGAGG - Intergenic
933625142 2:84589764-84589786 CTCAAAAAACATGAAGAGAAAGG + Intronic
934602148 2:95665840-95665862 GTACAGAAACAGGCAGAGGAGGG - Intergenic
935040077 2:99417584-99417606 GTGAAGACACAGGGAGAGGAGGG + Intronic
935315752 2:101831933-101831955 CTGAAAAGGCAGGCAGACAAGGG - Intronic
935429090 2:102955502-102955524 CTAAGGAAACAGACACAGAAAGG - Intergenic
935694858 2:105762257-105762279 CCGAGGAAACAGGCAGCTAATGG + Intronic
936147493 2:109990457-109990479 CTGAATAGACAGGCAAAGAAGGG - Intergenic
936197199 2:110380984-110381006 CTGAATAGACAGGCAAAGAAGGG + Intergenic
936229982 2:110692159-110692181 CTGAAAAGAGAGTCAGAGAAGGG - Intergenic
936396503 2:112135878-112135900 CTGAGGACAAAGACAGAGAAAGG + Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
936535505 2:113307995-113308017 GTTCAGAAACAGGCAGAGGAGGG - Intergenic
936796170 2:116206644-116206666 ATGAAGAACCAGCCAGAGATAGG - Intergenic
936824719 2:116567665-116567687 GTGAAGAAACAGCCACAGAATGG - Intergenic
937219013 2:120330809-120330831 GTGAAGACACAGGGAGAGGACGG + Intergenic
937508118 2:122559977-122559999 ATGAAGACAGAGGCAGAGATTGG + Intergenic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938031555 2:127998909-127998931 CTGATGACGCAGGCAGAGGAAGG + Intronic
938189093 2:129258163-129258185 TTGAAGAATGAGGTAGAGAATGG + Intergenic
938310537 2:130285942-130285964 CTGGAGGAGCAGGGAGAGAATGG + Intergenic
938512842 2:131969000-131969022 CAGAACAAAAAGGCAGAGGAAGG - Intergenic
938744536 2:134264783-134264805 CTGGAGAAACTGGCAAAGACAGG - Intronic
939194664 2:138957029-138957051 CTAAAGAAAAAGGGACAGAAAGG - Intergenic
940385394 2:153065384-153065406 CTGAAGGACTAAGCAGAGAATGG + Intergenic
940544149 2:155062023-155062045 CTGAAGCAACAGGCAAATTAGGG - Intergenic
940906063 2:159171045-159171067 CTTTAGATACAGGCAGAGATGGG + Intronic
941447881 2:165624873-165624895 AAGAGGAAACAGGCAGAGAGAGG + Intronic
941734476 2:168957977-168957999 CTGAATAAAAAGGCATACAAGGG + Exonic
942002503 2:171662880-171662902 GTGAAGACAGAGGCAGAGACTGG - Intergenic
942031501 2:171966317-171966339 CTGAAAATTCAGTCAGAGAATGG + Intronic
942171795 2:173296832-173296854 CACAAGAAAAAGGCAGAGAGAGG - Intergenic
943110226 2:183595513-183595535 GTGAAGACAGAGGCAGAGATTGG - Intergenic
943207371 2:184918207-184918229 CTGAATCAACAGGCAAAGGAGGG - Intronic
943715379 2:191146115-191146137 CTGAGGAAACACACAGAGATGGG + Intronic
944058614 2:195548291-195548313 CTGAAGAAAGAGGAAAGGAAAGG + Intergenic
944135230 2:196391896-196391918 GTGAAGACAGAGGCAGAGACTGG - Intronic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
944423147 2:199552542-199552564 GGGAAGAGACAGGTAGAGAAAGG + Intergenic
944464118 2:199983152-199983174 GTGAAGACAGAGGCAGAGATTGG + Intronic
944678736 2:202056388-202056410 TTGAAGAAACAGGTACTGAATGG - Intergenic
945026935 2:205628764-205628786 CTGAAGAAACAGGCAGCCTTGGG + Intergenic
945130014 2:206560753-206560775 CTGAAAAAACAGGAAGTCAACGG - Intronic
945243598 2:207698494-207698516 GTGAAGACACAGGGAGGGAATGG - Intergenic
945408711 2:209483942-209483964 CTAAAGGAACTGGCAGAAAATGG - Intronic
945620577 2:212131569-212131591 TTGAATCAACAGGCAAAGAAAGG + Intronic
945805384 2:214484074-214484096 GTGAAGATGCAGGCAGAGATTGG - Intronic
945950324 2:216033485-216033507 CTGAAGGAACTGGCAGAAAAGGG + Intronic
946064559 2:216975420-216975442 GTGAAGACAGAGGCAGAGACTGG - Intergenic
946166457 2:217867052-217867074 ATGAAGAAACAAGCACAGAGAGG - Intronic
946393104 2:219428573-219428595 CTGAAGAATAAAACAGAGAAGGG - Intergenic
946473875 2:219989177-219989199 ATGAAGACAGAGGCAGAGACTGG + Intergenic
946873325 2:224104796-224104818 CTGAGTCAACAGGCAAAGAAGGG - Intergenic
946992459 2:225350678-225350700 ATGAGGTAACAAGCAGAGAAGGG - Intergenic
947265000 2:228268750-228268772 CTGAAGAAACAAACATGGAAAGG + Intergenic
947598563 2:231430070-231430092 CTGAAAAAGCAGTCAGCGAAGGG + Intergenic
947669862 2:231929305-231929327 CTGGAAACACAGGAAGAGAAGGG + Intergenic
947759310 2:232592010-232592032 CAGAACAAAAAGGCAGAGTAGGG + Intergenic
948074882 2:235158289-235158311 CTGAAGCAAGAGACAGAGATGGG - Intergenic
948079707 2:235195735-235195757 CTGAGGAAAGAGGGAGAAAAGGG - Intergenic
948111186 2:235457181-235457203 ATGAAGACAGAGGCAGAGACTGG + Intergenic
948259347 2:236591283-236591305 GTGAAGACAGAGGCAGAGACGGG - Intergenic
948340223 2:237244702-237244724 CTGAATCAGCAGGCAAAGAAGGG - Intergenic
948436739 2:237958852-237958874 GTGAAGAAACAGGGAGAAGATGG - Intergenic
948655092 2:239471601-239471623 TAGAACAAAAAGGCAGAGAAGGG - Intergenic
948771504 2:240253429-240253451 ATGAAGACAGAGGCAGAGACGGG - Intergenic
1169570800 20:6903123-6903145 CATAAGAAAGAGGCAGAGAAAGG - Intergenic
1169626634 20:7578654-7578676 CTAAATCAACAGGCAAAGAAGGG - Intergenic
1169678766 20:8185425-8185447 CAGAAGGAAAAGGTAGAGAAGGG + Intronic
1169684279 20:8252947-8252969 CTGAGAAAACAGGCATAAAAAGG - Intronic
1169861473 20:10157566-10157588 GTGAGGATGCAGGCAGAGAAGGG - Intergenic
1170513538 20:17104343-17104365 CTCAAGAAACTGGGAGAGTAGGG - Intergenic
1170981986 20:21222712-21222734 GTGAAGACAGAGGCAGAGACAGG - Intronic
1171084613 20:22225994-22226016 TGGAGGAAACAAGCAGAGAACGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171329854 20:24327949-24327971 CTGAATCCACAGGCAAAGAAAGG - Intergenic
1172121258 20:32600185-32600207 CTGGAGAAAATGTCAGAGAAGGG + Intronic
1172499238 20:35413178-35413200 TTGAGGAAAGTGGCAGAGAACGG + Intergenic
1172529072 20:35618040-35618062 CAGAAGGAAAAGGAAGAGAATGG - Intronic
1172811360 20:37650437-37650459 CTGAAGAAACGGGGAGAGTGGGG + Intergenic
1173129952 20:40382891-40382913 CTGAAGAATCAGGCAGTGGAGGG - Intergenic
1173201298 20:40957190-40957212 CTGAAGGAAGCGGGAGAGAAGGG + Intergenic
1173324641 20:42021519-42021541 TAGAACAAAAAGGCAGAGAAGGG + Intergenic
1173452795 20:43180089-43180111 CAGAACAAAAAGGTAGAGAAGGG + Intronic
1173756469 20:45521084-45521106 CTGAATTAATAGGCAAAGAAAGG - Intergenic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174012286 20:47459762-47459784 TTGAAGAAAAAGGCAGAGGGAGG + Intergenic
1174053454 20:47783040-47783062 ATGAGGAAACAGGCACAGAGAGG - Intronic
1174189474 20:48729970-48729992 GTGAAGACAGAGGCAGAGATTGG + Intronic
1174204655 20:48829434-48829456 CTAAGGACACAGGGAGAGAATGG + Intergenic
1174511212 20:51054302-51054324 CAGAAGAAACAGACACAGAGAGG + Intergenic
1174519768 20:51120445-51120467 ATGAGGAAACAGGCACAGAGTGG + Intergenic
1174539980 20:51281581-51281603 TAGAACAAAAAGGCAGAGAAAGG + Intergenic
1174578749 20:51556086-51556108 ATGAAGACAGAGGCAGAGATGGG + Intronic
1175594742 20:60221997-60222019 CTGCAGACACATGCAGAGACCGG + Intergenic
1175611322 20:60353523-60353545 CTGTTGAAAGAGGCAGTGAATGG + Intergenic
1175717809 20:61267000-61267022 GTGAAGTCACAGGCAGAGATTGG + Intronic
1175838857 20:62014226-62014248 GTGAAGCCACAGGGAGAGAAGGG + Intronic
1176186645 20:63783879-63783901 CTGCTGAAACAGGCTGTGAAAGG + Intronic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1176665470 21:9683046-9683068 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1176780934 21:13193834-13193856 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
1176995422 21:15549925-15549947 GTGAAGATAGAGGCAGAGATAGG - Intergenic
1177978615 21:27882947-27882969 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
1178011628 21:28293484-28293506 CAGATGAAACAGGCAGTGGAAGG - Intergenic
1178102741 21:29287408-29287430 GTGAAGAAACAGGCACAAATGGG + Intronic
1178392446 21:32210187-32210209 ATGAAGAAACAGGCAAGAAAAGG - Intergenic
1178853520 21:36232499-36232521 GTGAAGACAAAGGCAGAGACGGG - Intronic
1179037401 21:37770406-37770428 GTGAATCAACAGGCAAAGAAGGG + Intronic
1179186477 21:39088979-39089001 GTGAAGACAGAGGCAGAGACTGG + Intergenic
1179274495 21:39879665-39879687 CTGAAGAGTCAGGCAGATACTGG + Intronic
1179530247 21:42013359-42013381 GTGAACACACAGGCAGAGATTGG - Intergenic
1179567764 21:42259966-42259988 CTGAAGAAACCAGGAGGGAAGGG - Intronic
1179721802 21:43320549-43320571 CTGAAGATACAGGGAGAAGACGG + Intergenic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1179893243 21:44348263-44348285 CTGGAGAAAAAGGCAGTGACAGG - Intergenic
1181054440 22:20253490-20253512 CTGGAGAAACACCCAGAGAAAGG + Intronic
1181332065 22:22100494-22100516 CAGAAGAAAGAGTCAGAGGAAGG - Intergenic
1181728146 22:24825788-24825810 CGGAAGAAACTGGCAGTGGAGGG - Intronic
1181769969 22:25118268-25118290 ATGAAGATAGAGGCAGAGATTGG - Intronic
1181839043 22:25638748-25638770 CTGAATCAGCAGGCAGAGAAGGG - Intronic
1181956744 22:26592769-26592791 AAGAAGAAACAGGCAGAAACTGG + Intronic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182028545 22:27139091-27139113 CTGGAGAAACAGGCAAGGATGGG - Intergenic
1182051688 22:27317258-27317280 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1182493653 22:30691427-30691449 GTGAAGAAGGAGTCAGAGAAGGG - Intergenic
1182509516 22:30809001-30809023 GTGAAGACACAGACAGAGAGGGG + Intronic
1182517542 22:30867545-30867567 CTGCAGAGACAGGCAGGGAGAGG - Intronic
1182753338 22:32658793-32658815 CTGAGGGAGAAGGCAGAGAAAGG + Intronic
1182820766 22:33214254-33214276 CTGAAGACACAGGGAGAAGATGG - Intronic
1183043272 22:35199535-35199557 CTGTGGCAACAGGGAGAGAAAGG - Intergenic
1183207661 22:36430848-36430870 TTGAAGAAACTGGCTGAGCACGG - Intergenic
1184350889 22:43943494-43943516 GTGATGAAACAGGCAGAGCACGG - Intronic
1184911173 22:47535282-47535304 ATGAAGACAGAGGCAGAGATTGG - Intergenic
1185234054 22:49700944-49700966 CAGCAGAAAGAGGCAGAGACAGG - Intergenic
1185241179 22:49748633-49748655 CTGGGGAAACAGGAAGACAAGGG - Intergenic
949984122 3:9525853-9525875 GTTATGAAACAGGCACAGAAAGG + Intronic
950192302 3:10985932-10985954 GTGAGGAAACAGGCACAGAGAGG - Intergenic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
950449397 3:13057227-13057249 CTGAAGACACAGCCAGGGGATGG + Intronic
950665042 3:14490214-14490236 ATGAGGAAACAGGCACAGAGAGG - Exonic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
951433000 3:22629920-22629942 TTGAAGAAATAAGCAGAGATGGG - Intergenic
951773738 3:26285860-26285882 ATGAAGTAACAGGGAGTGAATGG - Intergenic
951872935 3:27385709-27385731 ATGAGGAAGCAGGCAGAGAGTGG - Intronic
951902233 3:27668156-27668178 CAGCAGGAACAGGAAGAGAAAGG + Intergenic
952285851 3:31969290-31969312 CTAAACACTCAGGCAGAGAAAGG + Intronic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
952522881 3:34179699-34179721 GTGAAGACAGAGGCAGAGATTGG + Intergenic
952586344 3:34897408-34897430 GTGAAGACACAGGGAGAAAATGG - Intergenic
953120840 3:40039976-40039998 GTGAAGACAAAGGCAGAGATTGG - Intronic
953466217 3:43122162-43122184 GGGAAGAAACATGCAGAGCAGGG - Intergenic
953766326 3:45746545-45746567 ATGGAGGACCAGGCAGAGAAGGG + Intergenic
953851640 3:46469596-46469618 CTGAAGAGAGGGGCAGAGAATGG + Intronic
953957646 3:47244145-47244167 ATGCAGAAACAGGCACAGAGCGG + Intronic
954089692 3:48274376-48274398 CTGTAGAACCAGTGAGAGAAGGG + Intronic
954641563 3:52102436-52102458 GTGAAGACAAAGGCAGAGATTGG - Intronic
954653496 3:52179398-52179420 GTGAAGAAGGAGGCAGAGATTGG - Intergenic
954733069 3:52681827-52681849 AAGAAGAACAAGGCAGAGAAGGG + Intronic
954887877 3:53892417-53892439 AATAAGAAACAAGCAGAGAAAGG - Intergenic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955148513 3:56344055-56344077 CAGAGTAAACAGGCAGAGAGAGG + Intronic
955244775 3:57214532-57214554 CAGAAGAAACAGGCTCAAAAAGG - Intronic
955418411 3:58714190-58714212 CTGAGTCAACAGGCGGAGAAGGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
956319333 3:67978940-67978962 ATGGAGAAACAAGAAGAGAATGG - Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956729606 3:72184784-72184806 CTTTAGGAAGAGGCAGAGAAAGG - Intergenic
956801497 3:72763682-72763704 GTGAAGACAGAGGCAGAGATTGG + Intronic
957013351 3:75033384-75033406 GTGAGGAAATAGGGAGAGAAAGG + Intergenic
957749583 3:84395787-84395809 CTGAAAAATCAGGTTGAGAACGG - Intergenic
957875739 3:86144028-86144050 CCGAAGAGAGAGGCAGAGAAGGG - Intergenic
958141307 3:89565385-89565407 TGGAAGAAACAAACAGAGAAGGG + Intergenic
958144447 3:89605681-89605703 CTTAAGAAAAAAGCATAGAAGGG + Intergenic
958927418 3:100173890-100173912 ACAAAGAAACAGGCTGAGAAGGG - Intronic
959015573 3:101130309-101130331 TAGAACAAACAGGCAGAGGAAGG + Intergenic
959352136 3:105279160-105279182 CTGAATCAACAGGCAAAGAAGGG - Intergenic
959376452 3:105593900-105593922 CAGAACAATGAGGCAGAGAAAGG - Intergenic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
960301114 3:116003738-116003760 GTGAAGACAGAGGCAGAGACTGG + Intronic
960447238 3:117763478-117763500 CTAAAGAGAGAGGCTGAGAATGG - Intergenic
960515758 3:118600662-118600684 CTGAGGAAACATGCTCAGAAAGG + Intergenic
960584808 3:119310906-119310928 CTGAAGAAACAGGCTTTTAAAGG + Intronic
960781016 3:121316830-121316852 GTGAAAAAATGGGCAGAGAAAGG - Intronic
960908726 3:122627255-122627277 GTAAATAAACAGGAAGAGAATGG + Intronic
960925496 3:122792080-122792102 ATTAAGAAAGAGGCAGAGAGAGG + Intronic
960952695 3:123009979-123010001 CTGAAGACAAAGGCAGGAAAAGG + Intronic
961053763 3:123768900-123768922 CTGGAGAAGCAGGCAGAGAGGGG - Intronic
961314603 3:126026056-126026078 CTGAAGAGACCTGCAGAGCAGGG + Intronic
961385106 3:126518738-126518760 ATGAAGAAACAGGTGGAGAGAGG + Intergenic
961827020 3:129604443-129604465 ATGAAGAAACAGGCACAGAGAGG - Intronic
962134342 3:132718510-132718532 CTGAAGAAAGAAGAGGAGAATGG - Intronic
962254362 3:133860345-133860367 CTGAAGACAGAGGCGGAGAGTGG + Intronic
962803708 3:138911947-138911969 CTGGAGAAACAGGCACATTAAGG - Intergenic
962922737 3:139965510-139965532 CTGAGGGAAAAGGCAGAGAAGGG + Intronic
962970490 3:140396579-140396601 ATGAGGAAACAGGCACAGAGAGG + Intronic
963048906 3:141125600-141125622 CTGCAGAAATAAGCAGTGAATGG + Intronic
963129760 3:141847322-141847344 CTGAAGAAAGAGGCTCAAAATGG + Intergenic
963256784 3:143152866-143152888 CTTTGAAAACAGGCAGAGAATGG - Intergenic
963504368 3:146165027-146165049 CAGAAGAAACAGGAAGTGCAAGG + Intergenic
963610618 3:147463240-147463262 CTGAAGCAAATGGGAGAGAATGG - Intronic
963855741 3:150251422-150251444 CTGCAGGAACCAGCAGAGAAGGG + Intergenic
963941997 3:151104851-151104873 GTGAAGACAGAGGCAGAGATTGG - Intronic
964174252 3:153806274-153806296 GTGAAGACAGAGGCAGAGATTGG + Intergenic
964299676 3:155274525-155274547 CTGAAAAAAGAGTCAGCGAAGGG + Intergenic
964502895 3:157368230-157368252 CTGGAGACACAGGCACGGAAAGG - Intronic
964514009 3:157486611-157486633 ATGAGGAAACAGACATAGAAAGG - Intronic
965640379 3:170823442-170823464 CTGAAAAGAGAGTCAGAGAAGGG + Intronic
965833621 3:172826849-172826871 GTGAAGAGACAGTCACAGAATGG + Intergenic
965991569 3:174825432-174825454 TAGAACAAAAAGGCAGAGAAAGG - Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966661610 3:182420734-182420756 CTGAATCAACAGGAAAAGAAGGG + Intergenic
966757545 3:183385552-183385574 CACAAGAGACAGGCAGAGAAAGG + Intronic
966914668 3:184578158-184578180 ATGAAGACACAGGCAGGGATGGG - Intronic
967069747 3:185952462-185952484 CAGAACAACCAGGCAGAGAAAGG + Intergenic
967108988 3:186276564-186276586 GTGAAAAGACAGACAGAGAAAGG + Intronic
967189322 3:186972130-186972152 ATGAGGAAACAGGCATAGAGAGG + Intronic
967625003 3:191672016-191672038 CTGAAAAGACAGTCAGCGAAAGG + Intergenic
967885790 3:194332552-194332574 GTGAACAAAAAGGCAGAGGAAGG + Intergenic
967980773 3:195063896-195063918 ATGAAGAAACAGGCCCAGAGAGG + Intergenic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968531541 4:1094455-1094477 AGGAAGAAACAGGTAGAGAATGG + Intronic
968919771 4:3516507-3516529 CTGAAGCAGGAGGCAGAGGATGG + Intronic
969552172 4:7877548-7877570 GTGAGGAAACAGACACAGAAAGG + Intronic
969682485 4:8651025-8651047 CAGGAGAAAAAGGCAGAGGAAGG + Intergenic
969906800 4:10404732-10404754 ATGAGGAAACAGGCACAGAGAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970246209 4:14066508-14066530 CTGGAGTTACAGCCAGAGAAGGG + Intergenic
970476711 4:16431028-16431050 GTGAAGACAAAGGCAGAGATGGG - Intergenic
970486093 4:16526208-16526230 TAGAACAAAAAGGCAGAGAAAGG + Intronic
970639466 4:18048314-18048336 CAGTTGAAACGGGCAGAGAATGG - Intergenic
971130071 4:23798138-23798160 CTGAAAAGAGAGTCAGAGAAGGG - Intronic
971161280 4:24136659-24136681 GTGAGGAAACAGGCTGGGAAAGG - Intergenic
971261711 4:25063242-25063264 GTGAAGACAGAGGCAGAGATTGG + Intergenic
971356264 4:25897810-25897832 ATGAAGACAGAGGCAGAGACTGG - Intronic
971379734 4:26085752-26085774 GTGAAGACAGAGGCAGAGATTGG + Intergenic
971393981 4:26211934-26211956 CTGAAGACGAAGGCAGAGATGGG + Intronic
971399023 4:26258018-26258040 CTGCAGAAAGAGGCAGACACAGG + Intronic
971544882 4:27872844-27872866 CTGAAGCAAAAAGCAAAGAAAGG - Intergenic
971740126 4:30508550-30508572 CTGAATCAACAGCCAAAGAAGGG - Intergenic
972041518 4:34606989-34607011 CGGAACAAAAAGGCAGAGGAAGG + Intergenic
972093414 4:35317541-35317563 CTGAATCAACAGGTAAAGAAGGG + Intergenic
972716432 4:41650933-41650955 GTGAAGACAAAGGCAGAGAGGGG - Intronic
972997612 4:44901165-44901187 CTGAAGAAAATGACAGAGAAGGG - Intergenic
973152175 4:46901710-46901732 CAGAACAAAATGGCAGAGAAGGG + Intronic
973657549 4:53064815-53064837 CTGAAAAAACAGGCATAAAAAGG + Intronic
974120882 4:57637666-57637688 CTAAAGAAAAAGAGAGAGAAGGG - Intergenic
974288730 4:59903808-59903830 TAGAAGAAAAAGGCAGAGGAAGG - Intergenic
974500646 4:62697095-62697117 TTGTATACACAGGCAGAGAAAGG - Intergenic
974507424 4:62794305-62794327 GTGAAGACAGAGGCAGAGATTGG - Intergenic
974553795 4:63416708-63416730 GTGAAAAAACAAGCACAGAATGG - Intergenic
974821365 4:67070636-67070658 GTGAAGACAGAGGCAGAGATTGG + Intergenic
975094921 4:70446477-70446499 TTGAAGACAGAGGCAGAGATTGG - Intronic
975443157 4:74435722-74435744 CTGAGGAATCAGTCATAGAAAGG + Intergenic
975478935 4:74856419-74856441 GTGAAGACAGAGGCAGAGATAGG - Intergenic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
975533295 4:75422551-75422573 CAGAACAAGAAGGCAGAGAAAGG - Intergenic
975914383 4:79306380-79306402 GTGAAGATACAGGGAGAAAATGG - Intronic
976196568 4:82537764-82537786 ATGAAGACAGAGGCAGAGATTGG + Intronic
976245685 4:83003948-83003970 CTAAAGAAAAAGGCACAAAATGG + Intronic
976333897 4:83863525-83863547 GTGAAGAAACAAGTAGAGACTGG - Intergenic
976439444 4:85056334-85056356 GTGAAGAAAGAGGTGGAGAAAGG - Intergenic
976500164 4:85778677-85778699 TTGAAGAAAGAGACAGAGAGGGG - Intronic
976720814 4:88167169-88167191 CTAAAGAACCAAGCAGAGTAAGG + Intronic
976781593 4:88765127-88765149 CTTTAGAGACAGGCAGAGAGAGG - Intronic
977089275 4:92650558-92650580 CTGAATCAACAGGCAAAGAAGGG - Intronic
977131659 4:93247410-93247432 TAGAACAAAAAGGCAGAGAAAGG + Intronic
977337493 4:95717250-95717272 CTGAAGAAATAAACACAGAATGG + Intergenic
977499160 4:97816660-97816682 TAGAACAAAAAGGCAGAGAAAGG + Intronic
977532550 4:98217344-98217366 GTAAAGAAACAGGCAGAGTGAGG + Intergenic
977752945 4:100631671-100631693 CTAAATCAACAGGCAAAGAAGGG - Intronic
977804421 4:101279844-101279866 CAGAAGAAAAAGGCACACAATGG + Intronic
978277375 4:106968057-106968079 ATGAAGAAAGGGGGAGAGAAAGG + Intronic
978436858 4:108695016-108695038 AGGAAGAAAAAGGTAGAGAAGGG + Intergenic
978485706 4:109251568-109251590 CTGAATCAACAGGCAAAGAAGGG - Intronic
978489915 4:109301991-109302013 CTGAAGAAGCACGCAGGGAAAGG - Exonic
979010232 4:115357646-115357668 CTGAAGACTCAGACAGAGATTGG + Intergenic
979499810 4:121427071-121427093 GTGAAGATAGAGGCAGAGATAGG - Intergenic
979865751 4:125751153-125751175 ATGGAGAAAGTGGCAGAGAATGG - Intergenic
980480548 4:133381471-133381493 CAGAATAAAAAGTCAGAGAAGGG + Intergenic
980482848 4:133411050-133411072 ATGAAGAAAGAAGCAGATAAAGG - Intergenic
980705248 4:136484794-136484816 CTAAATGAACAGGCAAAGAAGGG - Intergenic
980780891 4:137490668-137490690 GTGAAGACAAAGGCAGAGACTGG - Intergenic
980928008 4:139158062-139158084 CCGAAGAAAGAGTCAGAGAAGGG + Intronic
981155914 4:141434813-141434835 CTGAAAAAACATGGACAGAAGGG - Intergenic
981219567 4:142215604-142215626 ATGAAGCAACATGCAGAGACTGG - Intronic
982085584 4:151832833-151832855 CTGGAAAAAAAGTCAGAGAAGGG - Intergenic
982207128 4:153005118-153005140 ATGAAGATAGAGGCAGAGATCGG + Intergenic
982246060 4:153352456-153352478 ATGAAGAAACAGACATAGAGAGG - Intronic
982384220 4:154782045-154782067 GGGAAGAAACAGGGAGACAAAGG - Intronic
982693956 4:158579087-158579109 GTGAAGACAGAGGCAGAGACTGG + Intronic
983638096 4:169918308-169918330 TTGGTGAAACAGGCAGAGAGGGG + Intergenic
984227204 4:177050069-177050091 TTGAAGAAAAAGGCTAAGAAGGG - Intergenic
984418060 4:179486020-179486042 CTGAATCAACAGGCAAACAAGGG - Intergenic
984537046 4:180989566-180989588 GTGAAGACAGAGGCAGAGATTGG - Intergenic
984730743 4:183065907-183065929 GTGAAGATAAAGGCAGAGATTGG + Intergenic
985023403 4:185715228-185715250 CTGATGTAACAGGCATAAAATGG + Intronic
985100574 4:186454242-186454264 CTGAAGAGACCCACAGAGAAAGG + Intronic
985201861 4:187492361-187492383 CTGGAGTTACAGGCAGAGATGGG - Intergenic
985410960 4:189683504-189683526 GTGAAGACAGAGGCAGAGATTGG - Intergenic
985832741 5:2247446-2247468 AAGAAGAAACAGGAGGAGAAGGG - Intergenic
985900312 5:2783515-2783537 GTGAAGACAGAGGCAGAGACTGG - Intergenic
985954166 5:3250180-3250202 CTGAAGAGACAGGCAAATACAGG - Intergenic
986256422 5:6104583-6104605 TTGAAGAGACACACAGAGAAGGG + Intergenic
986603631 5:9499350-9499372 ATAAAGAAAAAAGCAGAGAATGG + Intronic
986669573 5:10131056-10131078 GTGAAGACAGAGGCAGAGACTGG + Intergenic
986790492 5:11154866-11154888 GTGAAGACAAAGGCAGAGATTGG - Intronic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987524297 5:19028740-19028762 CTGATGACAGAGGCAGAGATTGG - Intergenic
987606492 5:20142685-20142707 GTGAAGAAAAAGGCAGTGACGGG + Intronic
987646160 5:20675304-20675326 CTGAATCAACAGGCGAAGAAAGG - Intergenic
987705219 5:21454873-21454895 CTGAACAAAGATGCAGTGAAGGG + Intergenic
987705690 5:21459943-21459965 CTGGAGAGAAAGGAAGAGAAAGG + Intergenic
987941412 5:24543821-24543843 CTGAAGAAAAATGAGGAGAATGG + Intronic
988288942 5:29259575-29259597 ATAAAGACACAGGCACAGAAAGG + Intergenic
988300707 5:29422324-29422346 CTGAACAAAGATGCAGTGAAGGG - Intergenic
988393367 5:30664814-30664836 GTGAAGACAGAGGCAGAGATTGG + Intergenic
988454397 5:31374233-31374255 CTGGAGAAGCTGGCAGACAATGG + Intergenic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
988714051 5:33807111-33807133 TTGCTGAAACAGACAGAGAAAGG - Intronic
988785112 5:34559679-34559701 CTGAAGACACAGGCAAAAGATGG - Intergenic
988924110 5:35971784-35971806 CTACAGCAACAGGCAGAAAAGGG - Intronic
989057579 5:37379754-37379776 CTGGAGAGAGAGGAAGAGAAAGG + Intronic
989071035 5:37512154-37512176 GTAAAGACAGAGGCAGAGAATGG - Intronic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
989270471 5:39527084-39527106 CTGAAGGAAGTGGCGGAGAAAGG + Intergenic
989378026 5:40785897-40785919 TTGAAGACAGAGGCAGAGACTGG + Intronic
989825978 5:45855657-45855679 CTGAAAAAACAGGCATAGATAGG - Intergenic
990160798 5:52937891-52937913 GTGAAGACAGAGGCAGAGATAGG - Intronic
990201323 5:53379050-53379072 CTGAGGAATCAGACAGTGAAGGG + Intergenic
990336726 5:54780505-54780527 TAGAACAAAAAGGCAGAGAAAGG + Intergenic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
990455638 5:55984474-55984496 GTGAATACACAGGCAGAGATTGG + Intronic
990559734 5:56972084-56972106 TGGAACAAAAAGGCAGAGAAAGG - Intergenic
990598049 5:57330873-57330895 TAGAAGAAAAAGGCAGAGGAAGG - Intergenic
990653555 5:57929479-57929501 TAGAACAAAAAGGCAGAGAAAGG + Intergenic
990978106 5:61576669-61576691 CAGAAGAAACAAGCAGAGACTGG + Intergenic
990982918 5:61617722-61617744 CTTAAGAGAAAGCCAGAGAAAGG - Intergenic
991098294 5:62762773-62762795 CTGAAGCAGAAGGCAAAGAAGGG - Intergenic
991201834 5:64003799-64003821 TGAAAGAAACAGGCAGAAAATGG - Intergenic
991428341 5:66515677-66515699 CTGAAGAAAGGGGGAGAGATGGG + Intergenic
992123438 5:73617325-73617347 ATGAAGAAATAGGTAGAAAAGGG - Intergenic
992178518 5:74174162-74174184 CTTAAGAAACAGGAAAAAAAAGG + Intergenic
992367217 5:76105125-76105147 GTGAAGACAGAGGCAGAGATTGG + Intronic
992880547 5:81105185-81105207 CTGCACTAACAGTCAGAGAATGG - Intronic
993012368 5:82498349-82498371 CTTAAGAAACTGGCAGTTAAGGG - Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993475371 5:88357866-88357888 TTGAACAAAAAGGCAGAGGATGG - Intergenic
993704287 5:91152189-91152211 CTAAAAAACCATGCAGAGAAGGG + Intronic
993719779 5:91310941-91310963 GAGAAGAAAGAAGCAGAGAAAGG - Intergenic
993739315 5:91518262-91518284 CTGAAGAAACTTACAAAGAAGGG - Intergenic
993824632 5:92667628-92667650 TTGAAGAAAAAAGAAGAGAATGG - Intergenic
993830694 5:92753877-92753899 ATGAAGAAACAGGGAGAAGATGG + Intergenic
994183621 5:96795163-96795185 CTAAAGAGAAAGGCACAGAAAGG + Intronic
994541224 5:101100847-101100869 CTGAAGAAAAAAACAAAGAATGG - Intergenic
994814782 5:104571307-104571329 TTTAAGAAACAGGCAAAGAACGG - Intergenic
995405741 5:111793477-111793499 TAGAAGAAAAAGGCAGAGGAAGG - Intronic
995483441 5:112615175-112615197 CTGAATCAACAGGAAAAGAAGGG - Intergenic
995709209 5:115017765-115017787 CTAAACAAGCAGGCATAGAAAGG + Intergenic
995913427 5:117214922-117214944 CTGAAGAAACAGCCAAAAGAAGG - Intergenic
995960734 5:117835903-117835925 CTGAAAAAAAATGCAAAGAAAGG + Intergenic
996272823 5:121628976-121628998 GTGACAAAAGAGGCAGAGAATGG - Intergenic
997341456 5:133148134-133148156 CAGTCAAAACAGGCAGAGAAGGG - Intergenic
997385978 5:133473070-133473092 CTAAAGAAACAGGGAGGGGAAGG - Intronic
997389440 5:133501963-133501985 GTGAAGACAGAGGCAGAGATGGG + Intronic
997584665 5:135037271-135037293 CTGAAGCAGCAGGCAGAGTCCGG - Intronic
997806140 5:136920103-136920125 ATCAAGACACAGGCAGAAAAGGG - Intergenic
998010185 5:138688670-138688692 GTGAAGATAGAGGCAGAGACTGG + Intronic
998107040 5:139475314-139475336 CTGAAGAGAAAGGCACTGAAAGG + Intergenic
998454246 5:142258687-142258709 GTGAAGAAAGAGGCAGAGATTGG + Intergenic
998633267 5:143925048-143925070 CTGAAAAGACAGTCAGCGAAGGG + Intergenic
998824055 5:146083305-146083327 GTGAAGACAAAGGCAGAGATGGG - Intergenic
998930361 5:147174562-147174584 AAGAAGAAACAGGCTTAGAAAGG + Intergenic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999266247 5:150268869-150268891 CTCAAGAGGGAGGCAGAGAAGGG - Intronic
999407412 5:151319042-151319064 CTGAGGAAACAAGCTGAGGAAGG - Intronic
999415095 5:151388080-151388102 CTGAAGAAAAAGGCCTAGAAAGG - Intergenic
999417843 5:151415390-151415412 CTGCAGGAACTGGCAGAGCAAGG - Intergenic
999490590 5:152046585-152046607 CTGAGGAAACAGCCAGGGCAAGG - Intergenic
999503955 5:152176127-152176149 CTGAAAAAACACTCAGAGATTGG - Intergenic
999797408 5:155001494-155001516 GTGAAGACAGAGGCAGAGATTGG + Intergenic
999840619 5:155421931-155421953 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1000193298 5:158934487-158934509 CTGGAGAAAGAGGAAGAAAAAGG - Intronic
1001120002 5:168972203-168972225 AGGAAGCACCAGGCAGAGAATGG + Intronic
1001244855 5:170098474-170098496 GTGAGGACACAGGCACAGAATGG + Intergenic
1001279420 5:170375867-170375889 ACGAGGAAACAGGCACAGAAAGG + Exonic
1001335951 5:170796846-170796868 CTGAAGAAAAAGGAAGATAGAGG + Intronic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1003609680 6:7599451-7599473 CTGCAAAAACAGGCAGCCAAAGG + Intronic
1003935118 6:10968243-10968265 CTGAAGAAACTGCTAGAGGAGGG + Intronic
1004218373 6:13723336-13723358 CAGAAAAGACACGCAGAGAAGGG + Intergenic
1004238967 6:13901456-13901478 AGGAACAAACGGGCAGAGAATGG + Intergenic
1004265121 6:14142627-14142649 GTGAAGACAGAGGCAGAGACTGG + Intergenic
1004298800 6:14438323-14438345 CTGAATCAACAGGCAAAGAAAGG + Intergenic
1004324800 6:14665036-14665058 CTGGAGAAACAGGCTGGAAAGGG - Intergenic
1004432298 6:15556081-15556103 CCTAAGAAACAGGCAGTTAAAGG + Intronic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1004675687 6:17839744-17839766 GTGAAGATGCAGGCAGAGACTGG + Intronic
1004690820 6:17990631-17990653 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1004881434 6:20012340-20012362 ATGAAGACAGAGGCAGAGATTGG + Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005840531 6:29742250-29742272 CTGGGGAAAGAGGGAGAGAAAGG - Intergenic
1005917117 6:30362575-30362597 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1005930924 6:30483229-30483251 GTGAAGAAGGAGGCAGAGACTGG - Intergenic
1005944492 6:30585481-30585503 CAGAGGAAGCAGGCAGACAACGG - Intronic
1006142874 6:31941368-31941390 TTGAAGACAGAGGCAGAGAATGG - Intronic
1006301729 6:33197121-33197143 CTCAACAAATAGGCAGTGAAAGG + Intronic
1006350004 6:33514043-33514065 GTGAAGACAGAGGCAGAGGATGG + Intergenic
1006799703 6:36752139-36752161 CTGGAGAACCAGGCAGCCAAGGG + Intronic
1007110780 6:39312533-39312555 GTGAAGAAACAGGCTCAGAGAGG - Intronic
1007213951 6:40221371-40221393 CTGAATCAACAAGCAAAGAATGG + Intergenic
1007214190 6:40223736-40223758 CTGAATCAACAAGCAAAGAATGG - Intergenic
1007296528 6:40826402-40826424 GTGAAGATAGAGGCAGAGATTGG + Intergenic
1007749567 6:44063661-44063683 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1007759583 6:44126114-44126136 CTGAAAACTCAGGCAAAGAAAGG + Intronic
1007800086 6:44384821-44384843 GGGAAGAAAGAGGCAGAGATTGG - Intergenic
1008164308 6:48117199-48117221 TGGAGGACACAGGCAGAGAAAGG + Intergenic
1008228796 6:48958041-48958063 CTGCAGAATCAGGCAGTGACAGG + Intergenic
1008359517 6:50598921-50598943 CTGAAAAAGCAGCCAGGGAAAGG + Intergenic
1008831418 6:55767472-55767494 ATGAGGAAACAGTCAGAGAGAGG + Intronic
1008900442 6:56608586-56608608 TTGAAGAAGCTGTCAGAGAAGGG - Intronic
1009022602 6:57960930-57960952 CTGGAGAGAGAGGAAGAGAAAGG - Intergenic
1009023084 6:57966033-57966055 CTGAACAAAGATGCAGTGAAGGG - Intergenic
1009359833 6:62797342-62797364 CTGAAAAGAGAGTCAGAGAAGGG - Intergenic
1009376830 6:62981774-62981796 CACAAGAAACAGGAAGAAAAGGG + Intergenic
1009464092 6:63950482-63950504 CTGAAAAGAGAGTCAGAGAAGGG - Intronic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010082609 6:71881714-71881736 GTGGAGACACAGGCAGAAAATGG - Intergenic
1010510655 6:76715070-76715092 ATGAAGAGAAAGGCAGAGAAGGG + Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010542089 6:77103912-77103934 CTGAACCAACAGGCAGAGAGAGG + Intergenic
1010777689 6:79905999-79906021 GTGAAGACACAGGCAGAGACTGG - Intergenic
1010918489 6:81650427-81650449 TAGAACAAAAAGGCAGAGAAAGG + Intronic
1010985023 6:82413694-82413716 CAGAAGAAACTGGGAGAGAGAGG + Intergenic
1011072652 6:83402521-83402543 CTGAATTAACAGGCCAAGAAAGG + Intronic
1011182617 6:84637857-84637879 GTAAGAAAACAGGCAGAGAAGGG - Intergenic
1011248937 6:85349891-85349913 GTGAAGACACAGGCAGAGGGTGG - Intergenic
1011603244 6:89079317-89079339 CTGGGGAAACAGGCTTAGAAAGG - Intergenic
1011654247 6:89535369-89535391 CTGAGGAAACATGCAGACTATGG - Intronic
1011762198 6:90579337-90579359 AAGCAGAGACAGGCAGAGAAGGG - Intronic
1012520106 6:100110899-100110921 CAGAAGAAATAGGCTGAGATGGG + Intergenic
1012627289 6:101419671-101419693 AGGAAGAAACAGGCTGAGAGAGG + Intronic
1012849463 6:104429533-104429555 CTAAAGAGAGAAGCAGAGAAGGG + Intergenic
1012926842 6:105275873-105275895 CTAAAAAAGCAGGCAGAGAAAGG + Intergenic
1013063890 6:106663922-106663944 GTGTAGAAAGAGGAAGAGAAGGG - Intronic
1013069549 6:106716209-106716231 TAGAGGAAACAGGAAGAGAATGG - Intergenic
1013148832 6:107424605-107424627 CTGAAGATACAGGCTGTGTAAGG + Intronic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1013790401 6:113829850-113829872 GTGGGGAAGCAGGCAGAGAATGG + Intergenic
1014173513 6:118306129-118306151 CTGAAACAATAGGCAAAGAAGGG - Intronic
1014428869 6:121342244-121342266 TAGAAAAAACAGGCAGAGAGTGG + Intergenic
1015050782 6:128837008-128837030 CAGCAGAATCTGGCAGAGAAAGG - Intergenic
1015126885 6:129764863-129764885 CAGAGGAAAGAGGGAGAGAAAGG + Intergenic
1015343146 6:132125480-132125502 AGGAAGAAAAAGGGAGAGAAGGG - Intergenic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1015801618 6:137066192-137066214 CAGTAGAGACAGGGAGAGAAGGG + Intergenic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1015867334 6:137740446-137740468 GTGAAGACAAAGGCAGAGACTGG + Intergenic
1016294283 6:142557927-142557949 CAGAACAAAAAGGCAGAGTATGG + Intergenic
1016581063 6:145629740-145629762 CTGGAGAGACAGGCACAGCAGGG - Intronic
1016697815 6:147018132-147018154 GTGAAGACAGAGGCAGAGACAGG - Intergenic
1016709867 6:147157170-147157192 CCAAAGAAACAGGCTAAGAAGGG + Intergenic
1016728360 6:147401087-147401109 CTGAAGCAACAGCCTGAGCAGGG + Intergenic
1016793794 6:148095770-148095792 CTGAGGAAACAGGAACAGAGTGG - Intergenic
1017135843 6:151146795-151146817 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1017619472 6:156281021-156281043 TTGAAGAAACAGGAAATGAATGG - Intergenic
1017637296 6:156456040-156456062 ATGAAGACAGAGGCAGAGATTGG - Intergenic
1017667317 6:156733094-156733116 ATGTGGGAACAGGCAGAGAAAGG - Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017918066 6:158848006-158848028 GTGAAGACACAGGCAGAAGACGG + Intergenic
1018151359 6:160942830-160942852 ATGAAGAAATAGCAAGAGAATGG - Intergenic
1018220343 6:161571858-161571880 CAGAACAAGAAGGCAGAGAACGG + Intronic
1018568637 6:165184122-165184144 GTGAAGACAGAGGCAGAGATGGG - Intergenic
1019006238 6:168799040-168799062 CTGAAGAAACAGGGTGTGATGGG + Intergenic
1019027479 6:168980591-168980613 CCCAGGAAACTGGCAGAGAAAGG + Intergenic
1019222091 6:170480952-170480974 CTGAATCAACAGACAAAGAAAGG + Intergenic
1019708223 7:2506595-2506617 GTGAAGAAAGAGGCAGAGTTGGG + Intergenic
1019892993 7:3962163-3962185 GTGAGGAAACAGACAAAGAAAGG + Intronic
1020048015 7:5057992-5058014 CTGGAGAAAGAGGAAGTGAATGG - Intronic
1020505731 7:8985389-8985411 CTTAAGTAACAGGGAGAAAAAGG + Intergenic
1020627603 7:10601201-10601223 GTGAAGATGCAGGCAGAGACTGG + Intergenic
1020687966 7:11319168-11319190 ATGATAAAATAGGCAGAGAATGG - Intergenic
1020736878 7:11961260-11961282 ATGAAGAATCTGGTAGAGAAGGG + Intergenic
1021120836 7:16793700-16793722 ATAATGAAACAGGCAGAGAGAGG + Intronic
1021990876 7:26140192-26140214 ATGAAGACAGAGGCAGAGATTGG - Intergenic
1022273279 7:28831298-28831320 CAGAAGAAAGAGGCAGAAAGAGG + Intergenic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022734854 7:33065823-33065845 CTCAAGAAAAAGGAAAAGAATGG + Intergenic
1022738647 7:33100185-33100207 CTCAAGAAACCAGCAGAGGATGG + Intronic
1022804738 7:33810222-33810244 CTGAAGAAACACTGAGACAAAGG - Intergenic
1023054057 7:36277801-36277823 CTGAAGAAGAAGGCAGAGCGAGG + Intronic
1023237149 7:38101350-38101372 ATGAAGACAGAGGCAGAGATTGG + Intergenic
1023443289 7:40206325-40206347 TTGAAGAAACATGCAAAGAATGG - Intronic
1023677392 7:42644617-42644639 CTGAGGCAAAAGGCAGAAAAGGG + Intergenic
1023680684 7:42684389-42684411 CTGAAGATAGAGGCAGAGGGAGG + Intergenic
1024103582 7:46058734-46058756 GTGAAGATACAGGCAGAAGATGG + Intergenic
1024594365 7:50919331-50919353 CTGAAGAAAAAGGCAGCAAAAGG - Intergenic
1024610712 7:51061717-51061739 CAGAACAAAAAGGCAGGGAAGGG + Intronic
1025154995 7:56596889-56596911 TTGAAAAATCAGGCAAAGAAAGG + Intergenic
1026105537 7:67417930-67417952 ATGAAGCAAGAGGCAGAGCAGGG - Intergenic
1026397730 7:69974640-69974662 CAGAACAAAAAGGCAGAGGAAGG - Intronic
1026540804 7:71278486-71278508 GTGAAGACAGAGGCAGAGATTGG - Intronic
1027007782 7:74710126-74710148 CTGAAGCAACAAGCAAAAAAAGG - Intronic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1027940611 7:84674203-84674225 CTGAAGTAAAGAGCAGAGAAAGG + Intergenic
1028385512 7:90248850-90248872 ATGAGGAAACAGACACAGAAAGG - Intronic
1028618812 7:92801485-92801507 ATGAGGAAACAGGCAGGGAATGG + Intronic
1028738042 7:94240152-94240174 CTGAAGAAAAAGGGACAGAGTGG - Intergenic
1028821120 7:95213116-95213138 CTCAAAAAACAAGCAGAGAAGGG - Intronic
1029127318 7:98303566-98303588 CTGAAGAGGCAGGCAGAGTCCGG + Intronic
1029568733 7:101357361-101357383 ATGGAGAAACAGGGAGACAAAGG - Intergenic
1030249700 7:107428433-107428455 GTGAAGATAGAGGCAGAGACTGG + Intronic
1030326661 7:108226902-108226924 TTGAAGAATCAGGCAGCAAATGG + Intronic
1030682372 7:112447598-112447620 CTGAAGAAAAAGGCAAAGTCTGG + Intronic
1030860934 7:114627547-114627569 GTGAAGAAATAGGAAGAGGATGG - Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031573486 7:123387283-123387305 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1031628959 7:124022750-124022772 CTGAATCAACAGGCAAAAAAGGG + Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032001934 7:128271322-128271344 CTGAGGAAACAGGCCCAGAATGG - Intergenic
1032490448 7:132320343-132320365 GTGAAGACAAAGGCAGAGATTGG - Intronic
1032799823 7:135309085-135309107 GAGAAGAAACAGGGAGAGAGAGG + Intergenic
1032858082 7:135853538-135853560 CTGAAGCAAGAGGCAAAAAAGGG - Intergenic
1033144196 7:138856942-138856964 CAGAAGAAAAAGACAGAGGAAGG + Intronic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033212245 7:139468543-139468565 CTGAAAAAAGAGTCAGCGAAGGG - Intronic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1034344323 7:150376879-150376901 GTGATGAACCAGGCAGAGCAAGG - Intronic
1034673414 7:152873768-152873790 CTGAAGAAATAGGTAGGAAAGGG + Intergenic
1034695548 7:153050044-153050066 CTGAAGAAACAGGCCAGGCACGG + Intergenic
1034715350 7:153236451-153236473 ATGAAGATAAAGGCAGAGATTGG - Intergenic
1034782087 7:153889607-153889629 CTGAAGTAAAACGCAGAGAGGGG - Intronic
1034934944 7:155193009-155193031 TTGAAGACAGAGGCAGAGACTGG + Intergenic
1035067237 7:156115672-156115694 CTGAAGATAAAGGCAGAGACAGG + Intergenic
1035237482 7:157508346-157508368 CTACAGAGAGAGGCAGAGAAGGG + Intergenic
1035352398 7:158255869-158255891 CAGCTGGAACAGGCAGAGAAAGG - Intronic
1035402716 7:158577680-158577702 CTGATAAAACAGACAGATAAAGG + Intronic
1035490143 7:159268845-159268867 CTGTAAAAAGAGGCAAAGAAGGG - Intergenic
1035526244 8:315507-315529 GTGAAGACACAGGGAGAGGATGG - Intergenic
1035638868 8:1167379-1167401 AGGAAGAAAAAGGCAGAGAGGGG + Intergenic
1035831115 8:2695304-2695326 CTGAAGAAGAAGGCAGAGGTTGG - Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036486492 8:9184174-9184196 CTGAAAAGAGAGGCAGCGAAGGG + Intergenic
1036527064 8:9545147-9545169 CTGAATTAACAGGTAAAGAAGGG - Intergenic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037218814 8:16490867-16490889 CGGAAGAAACACACAGAGACAGG + Intronic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037341041 8:17845450-17845472 ATGAAGAAACAGTCAGATAGAGG - Intergenic
1037857019 8:22379102-22379124 GTGAAGACAGAGGCAGAGATGGG - Intronic
1037865149 8:22437422-22437444 CTCAAGAAACAGGCAGAGTACGG + Intergenic
1038146767 8:24904558-24904580 GTGAAGACACAGGGAGAGGACGG + Intergenic
1039279876 8:35972637-35972659 ATGAAGACACTGGCAGAGATAGG + Intergenic
1039361521 8:36882472-36882494 GAGAAAAAAGAGGCAGAGAAGGG - Intronic
1039751421 8:40482245-40482267 ATGAAGACAGAGGCAGAGATTGG + Intergenic
1039827762 8:41189440-41189462 GTGAAGATGGAGGCAGAGAACGG - Intergenic
1040705717 8:50124210-50124232 GTGAAGACACAGGGAGAAAATGG + Intronic
1040731970 8:50458211-50458233 CTGAGGAAACAGACAAAGCAAGG + Intronic
1040802976 8:51363869-51363891 CTGGAGAAATAGCCAGAGATAGG + Intronic
1041224005 8:55680443-55680465 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1041405144 8:57490754-57490776 GTGAAGACACAGGGAGAAAATGG + Intergenic
1041531721 8:58875865-58875887 CTGAAGATACAGTCCCAGAATGG - Intronic
1042241466 8:66668082-66668104 CTTAGGAAACAGGCCCAGAAAGG + Intronic
1042795075 8:72653029-72653051 GTGAAGACAGAGGCAGAGATTGG - Intronic
1042966677 8:74361086-74361108 GTGGAGAAAAAGGAAGAGAAGGG - Intronic
1043325629 8:79047522-79047544 CTGAATCAACAGGCAAAGATGGG - Intergenic
1043356455 8:79418327-79418349 GTGAAGAAAAAGGCCGAGACTGG + Intergenic
1043494861 8:80789907-80789929 AAGAAGAAATAGTCAGAGAAAGG + Intronic
1043567460 8:81563120-81563142 CTGGATTAACAGGCAGAGACTGG - Intergenic
1043599468 8:81919779-81919801 CTGAAAAGACAGTCAGTGAAGGG - Intergenic
1044490555 8:92809242-92809264 CTGAAGGCACAGGCACAGGATGG + Intergenic
1044954793 8:97468740-97468762 CTGAAGAACCAGACAGGAAAGGG - Intergenic
1045075330 8:98559925-98559947 CTAAAGAAACAAGCAGAGAAGGG + Intronic
1045371072 8:101523429-101523451 CTGAAGAAACAAGCTGGGACGGG - Intronic
1045429046 8:102096278-102096300 GTGAAGACACAGGGAGAGGAAGG - Intronic
1045507274 8:102787705-102787727 CTGAAGACAGAGACAGAGATTGG - Intergenic
1045660046 8:104427937-104427959 CTGAAGAACTAGGCAAAGCAAGG + Intronic
1045799342 8:106083793-106083815 CTGTAGAAACATGTAGAGAAAGG - Intergenic
1045861642 8:106820455-106820477 AGGAAGAAAGAGGGAGAGAAAGG - Intergenic
1046017273 8:108620231-108620253 TTGAAGAATCTGGCAGATAATGG + Intronic
1046130124 8:109956257-109956279 CTGGAGAGACAGGCAAAGACAGG - Intergenic
1046220906 8:111213138-111213160 ATGAAGACAAAGGCAGAGACTGG + Intergenic
1046384952 8:113497106-113497128 CTGAATAAACAGGCAAAGAGTGG + Intergenic
1046630305 8:116617062-116617084 CTTAGGAAGCAGGCAGAGAGAGG + Intergenic
1046634893 8:116663314-116663336 ATGAAGAAACAGGCACTGATTGG + Intronic
1046748675 8:117903641-117903663 CTGAAGAAAAAGGAGGAAAATGG - Intronic
1046865642 8:119147254-119147276 CTGAAATGACAGGCAAAGAAAGG - Intergenic
1046883562 8:119337528-119337550 CTGAAGAAGGCAGCAGAGAAAGG - Intergenic
1047042201 8:121008403-121008425 CTGAAGAATCAGGGAATGAAAGG - Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047212274 8:122849573-122849595 GTGAAGACAGAGGCAGAGATGGG - Intronic
1047218861 8:122902415-122902437 CTGAGGAAACAGGCACAGAGAGG - Intronic
1047366469 8:124216228-124216250 GTGAAGTCACAGGCAGAGATTGG - Intergenic
1047989326 8:130269216-130269238 CTTAAGAAAAAGGCAGAGTCTGG + Intronic
1048253369 8:132885900-132885922 GTGAAGACACAGGCACAGATTGG - Intronic
1048263578 8:132965970-132965992 CTGAAGACAGAGTCAGGGAATGG + Intronic
1048301086 8:133251917-133251939 GTGAAGACAGAGGCAGAGAGTGG + Intronic
1048413406 8:134199406-134199428 CATTAAAAACAGGCAGAGAAGGG + Intergenic
1048518495 8:135132436-135132458 CAGAAGAAACAGGCAGTGCTGGG + Intergenic
1048579887 8:135722225-135722247 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1048590479 8:135816617-135816639 ATGAAGAAAGAGGCAGAGATTGG + Intergenic
1048604873 8:135957014-135957036 AGGAAGAACCAGGCAGAGAAAGG + Intergenic
1049229010 8:141472599-141472621 CTGAGGGAACAGGCAGGGAGGGG - Intergenic
1050060430 9:1703669-1703691 CTAAAGAAAGAAGCACAGAAGGG + Intergenic
1050663593 9:7910542-7910564 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1051189878 9:14500160-14500182 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1051550922 9:18328549-18328571 CTGAAGAAACATACCCAGAAGGG + Intergenic
1052307305 9:27024714-27024736 CTGAAGGAGCCAGCAGAGAAAGG + Intronic
1052393106 9:27904407-27904429 CTCAAAAAGCAGGCAGGGAAGGG + Intergenic
1053343859 9:37363556-37363578 GTGAAGACAGAGGCAGAGACTGG - Intergenic
1053523750 9:38808174-38808196 CTGAATCAACTGGCAAAGAAGGG - Intergenic
1054195979 9:62032588-62032610 CTGAATCAACTGGCAAAGAAGGG - Intergenic
1054642426 9:67556101-67556123 CTGAATCAACTGGCAAAGAAGGG + Intergenic
1054974092 9:71121821-71121843 GTGAGGACACAGGGAGAGAAGGG + Intronic
1055243599 9:74215609-74215631 CTTAACAAAGAGGTAGAGAAGGG - Intergenic
1055431483 9:76248410-76248432 GTGAAGAAAAAGGAAGAGAGAGG + Intronic
1055553710 9:77454632-77454654 CTAAAGAAACAGTCTCAGAATGG - Intronic
1056137302 9:83642888-83642910 CTGGAGAAAGCGGGAGAGAAGGG - Intronic
1056194460 9:84215758-84215780 CTGAAGAAACAAACAAAGCAGGG - Intergenic
1056247009 9:84705617-84705639 CTCAAGAAAAAGGCAGAGAGAGG - Intronic
1056506554 9:87263509-87263531 GAGTAGAAACAGGCAGGGAAAGG - Intergenic
1056588005 9:87940769-87940791 ATGAAGAAACAACCAGAGAATGG - Intergenic
1056608862 9:88112176-88112198 ATGAAGAAACAACCAGAGAATGG + Intergenic
1057098989 9:92339750-92339772 CTGAAGACTCAAGCAGAGAATGG + Intronic
1057283827 9:93731537-93731559 CTGAGGATACAGGCAGAGACTGG - Intergenic
1057327985 9:94083759-94083781 CTGCAACAAAAGGCAGAGAATGG + Intronic
1057334381 9:94144297-94144319 CTGCAAAAACAGGCAGACAAGGG - Intergenic
1057424081 9:94934824-94934846 CTGAAGACACAGGCAGGCAAAGG - Intronic
1057441212 9:95084985-95085007 CTGAAGAAAAATGCAGGGACCGG - Intronic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1057744946 9:97743778-97743800 ATGAAGACAGAGGCAGAGATTGG + Intergenic
1057904852 9:98975531-98975553 ATGAAGAAACAAACAGAGCAGGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1057973573 9:99580281-99580303 CTGAAGATACAGGCATAAAGAGG - Intergenic
1058025030 9:100133260-100133282 CTGAGGAGACAGGGAAAGAAGGG - Intronic
1058372409 9:104285068-104285090 CACAACAAAAAGGCAGAGAAAGG - Intergenic
1058419927 9:104823879-104823901 CAGAAGAGACTGGCAGAAAAGGG + Intronic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058794901 9:108488568-108488590 GTGAAGACAGAGGCAGAGAATGG - Intergenic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059428047 9:114233368-114233390 AGGTAGAAACAGGTAGAGAAAGG - Intronic
1059493556 9:114690407-114690429 CAGAACAAAAAGGCAGAGGAAGG - Intergenic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059863797 9:118491036-118491058 CTGAAAAGAGAGTCAGAGAAGGG + Intergenic
1059893567 9:118833362-118833384 TTGAATTAACAGGCAAAGAAGGG + Intergenic
1059910148 9:119034362-119034384 GTGAAGACACAGGGAGAGGATGG - Intergenic
1060066045 9:120501971-120501993 ATGAGGAAACAGGCTGAGACAGG + Intronic
1060247089 9:121956356-121956378 CTTAAGAAACCCGCATAGAAAGG + Intronic
1060421498 9:123472693-123472715 CTGCAGAAGCAAGCAGAGTATGG + Intronic
1060458469 9:123824170-123824192 CAGAAGAAACAGGCTCAGAGAGG + Intronic
1060759839 9:126237943-126237965 GTGAAGACAAAGGCAGAGATGGG + Intergenic
1060820830 9:126660868-126660890 ATGATGAAACAGGCAGTGACAGG + Intronic
1060872700 9:127055599-127055621 ATGAGGAAACAGACACAGAAAGG + Intronic
1060920511 9:127417500-127417522 ATGAAGAAACAGGCCGAGAGGGG - Intergenic
1061316779 9:129801365-129801387 ATGAAGAATCAGGCAGAGACTGG - Intergenic
1061381843 9:130263547-130263569 CTTAAGGAACAAGCAGGGAAGGG - Intergenic
1062514823 9:136927527-136927549 CTGAAGACACGGGAAGAGACTGG - Intronic
1203660628 Un_KI270753v1:38714-38736 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1203671802 Un_KI270755v1:21932-21954 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1185632526 X:1525421-1525443 GTGAAGACAGAGGCAGAGATTGG + Intronic
1185710296 X:2298116-2298138 GTGAAGACAGAGGCAGAGACTGG + Intronic
1185955343 X:4483044-4483066 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1186372143 X:8958197-8958219 CTGAAGACAGAGCAAGAGAAGGG - Intergenic
1186409750 X:9336383-9336405 GTGAAGACAGAGGCAGAGACTGG + Intergenic
1186726213 X:12361885-12361907 GTGAAGACACAGGCAGAGATTGG - Intronic
1186903079 X:14079108-14079130 GTGAAGACGCAGGCAGAGATTGG + Intergenic
1186967163 X:14800353-14800375 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1186979363 X:14942562-14942584 GTCAAGAAACATGCAAAGAATGG + Intergenic
1187153655 X:16704255-16704277 ATGAAGGAATAGGCACAGAAAGG - Intronic
1187898291 X:24003211-24003233 ATAAGGAAACAGGCACAGAAAGG - Intronic
1188649713 X:32617058-32617080 CTGAATCCACAGACAGAGAAAGG + Intronic
1188690113 X:33118890-33118912 GTGAAGAAGCATGCTGAGAAAGG - Intronic
1188843355 X:35043316-35043338 CCAAAGACACAGGCAGGGAAAGG + Intergenic
1189246029 X:39564242-39564264 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1189252962 X:39615130-39615152 CTGAAGAAAGAGCCATAGAGGGG - Intergenic
1189943242 X:46150095-46150117 GTGAAGAAAGAGGCAGAAATTGG - Intergenic
1190086250 X:47397771-47397793 CTGAAGCAACAGGAAAAGAAGGG - Intronic
1190119467 X:47648802-47648824 ATGAAGAAAAAGGCACAGAGAGG + Intronic
1190372199 X:49753509-49753531 GTGAAGATAGAGGCAGAGACTGG + Intergenic
1190756996 X:53409795-53409817 ATGAGGAAACAGGTACAGAAAGG - Intronic
1190765914 X:53475581-53475603 TTGAATCAACAGGCAAAGAAGGG + Intergenic
1191218634 X:57960929-57960951 CTGAAGATACAGGGAGAAAGAGG + Intergenic
1192100010 X:68254487-68254509 CTGAAGAAATAGGAAGAAAGAGG - Intronic
1192122974 X:68474557-68474579 CTCAAGAAAGAGGAACAGAATGG + Intergenic
1192566172 X:72165358-72165380 CTTAGGAAACAGACAGGGAAGGG + Intergenic
1192572284 X:72216226-72216248 ATGAAGATGGAGGCAGAGAATGG + Intronic
1192607242 X:72531068-72531090 CTGAAGAATTAGCCAGAGCAAGG + Intronic
1193628138 X:83844942-83844964 CTGAGGAAAATGGCAGAGAGTGG + Intergenic
1193876209 X:86865596-86865618 CTGAATTAACAGGCAAAGAAGGG + Intergenic
1194330863 X:92581709-92581731 ATTAAGTAACAGGCAGAGATTGG + Intronic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1194424216 X:93716994-93717016 CTAAATCAACAGGCACAGAAGGG - Intergenic
1194599564 X:95903754-95903776 ATGAAGAGTCAGGCAGAGAGAGG - Intergenic
1195098729 X:101532437-101532459 CTGAACTGACAGGCAGGGAAAGG + Intronic
1195163782 X:102197505-102197527 GTGAAGGAAAAGGAAGAGAAAGG - Intergenic
1195302109 X:103540392-103540414 GTGAAGAAGGAGGCAGAGATTGG - Intergenic
1195652051 X:107295227-107295249 CAGAACAAGCAGGCACAGAAGGG + Intergenic
1195673191 X:107485962-107485984 GAGAAGACAAAGGCAGAGAATGG - Intergenic
1195958835 X:110364172-110364194 CTGAAGACAGAGGCAGGGATTGG - Intronic
1196239790 X:113329772-113329794 TTGAACAAAAAGGCAGAGGAAGG - Intergenic
1196529602 X:116770094-116770116 GTGAAGATACAGGCGGAGATTGG - Intergenic
1196575828 X:117317881-117317903 ATGAAGAAAAGGGCACAGAAAGG + Intergenic
1196746915 X:119079438-119079460 ATGAAGAGAAAGACAGAGAAAGG + Exonic
1196933632 X:120707027-120707049 CTAAAGAAACAGGCCGGGCACGG + Intergenic
1197017530 X:121644878-121644900 TTCAGGAAACAGGAAGAGAAAGG + Intergenic
1197029133 X:121792449-121792471 GTGAAGAAAGAGGCAGAGATTGG - Intergenic
1197286660 X:124603027-124603049 ATGAAGACAGAGGCAGAGACTGG + Intronic
1197367643 X:125583631-125583653 GTGAAGACAAAGGCAGAGACTGG + Intergenic
1197526233 X:127567328-127567350 CTGAATAAACAGGAAGGGATTGG - Intergenic
1197540588 X:127755343-127755365 CTGAATCAACAGGCAAATAAGGG + Intergenic
1197948788 X:131871973-131871995 CTAAACCAACAGGCAAAGAAGGG - Intergenic
1198056302 X:132998915-132998937 GTGAAGAAACAGGCCCAGAAAGG + Intergenic
1198161882 X:134016176-134016198 CTGATGAAAAAGGGGGAGAAAGG + Intergenic
1198666168 X:139025601-139025623 CTGAAAGAAAAGGGAGAGAATGG - Intronic
1198706146 X:139450649-139450671 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1198805466 X:140490018-140490040 CTGAATAAACATACAGAAAATGG + Intergenic
1198809708 X:140523103-140523125 CTGGAGAAACCAGCAGAGGATGG + Intergenic
1199249294 X:145640586-145640608 GTGATGATAAAGGCAGAGAAGGG - Intergenic
1199494578 X:148438889-148438911 CTGGAGAAACAGGCAGGGTCAGG + Intergenic
1199569478 X:149253139-149253161 CTGAGTAAACAGGCAGAGGTTGG - Intergenic
1199676979 X:150197267-150197289 GTGAAGACAAAGGCAGAGACTGG + Intergenic
1199761575 X:150908321-150908343 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1199915240 X:152332651-152332673 CTGGAACAACCGGCAGAGAACGG + Intronic
1199948761 X:152688691-152688713 GTGAAGACACAGGAAGAGAATGG + Intergenic
1199960915 X:152779758-152779780 GTGAAGACACAGGAAGAGAATGG - Intergenic
1200169728 X:154063858-154063880 GTGAAGACACAAGCAGAGAATGG + Intronic
1200639563 Y:5700780-5700802 ATTAAGTAACAGGCAGAGATTGG + Intronic
1201365856 Y:13205499-13205521 CTGAAAAAAGAGTCAGAAAAGGG + Intergenic
1201640791 Y:16174535-16174557 CTGAAAAGAAAGTCAGAGAAGGG + Intergenic
1201662025 Y:16410791-16410813 CTGAAAAGAAAGTCAGAGAAGGG - Intergenic
1201685999 Y:16703060-16703082 CTGAAAAAGCAGGCAGAAGAAGG - Intergenic
1201936107 Y:19412356-19412378 CTGAAAAGACAGTCAGTGAAGGG - Intergenic
1202048972 Y:20761466-20761488 CCGGACAAACAGGCAGAGATAGG - Intronic
1202257017 Y:22932074-22932096 CTGAGGAGGCAGGAAGAGAATGG - Intergenic
1202410008 Y:24565822-24565844 CTGAGGAGGCAGGAAGAGAATGG - Intergenic
1202460774 Y:25104250-25104272 CTGAGGAGGCAGGAAGAGAATGG + Intergenic
1202576480 Y:26331955-26331977 CTGAAGAAACAAACATAGAGAGG - Intergenic