ID: 1001377012

View in Genome Browser
Species Human (GRCh38)
Location 5:171269577-171269599
Sequence CTCTTCAGGGCTGATTTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001377012_1001377018 11 Left 1001377012 5:171269577-171269599 CCTTATAAATCAGCCCTGAAGAG 0: 1
1: 0
2: 3
3: 13
4: 133
Right 1001377018 5:171269611-171269633 AAGATTCAGCCTGTTACCAGTGG 0: 1
1: 0
2: 1
3: 12
4: 132
1001377012_1001377019 12 Left 1001377012 5:171269577-171269599 CCTTATAAATCAGCCCTGAAGAG 0: 1
1: 0
2: 3
3: 13
4: 133
Right 1001377019 5:171269612-171269634 AGATTCAGCCTGTTACCAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 111
1001377012_1001377021 24 Left 1001377012 5:171269577-171269599 CCTTATAAATCAGCCCTGAAGAG 0: 1
1: 0
2: 3
3: 13
4: 133
Right 1001377021 5:171269624-171269646 TTACCAGTGGGATTTTGTATTGG 0: 1
1: 0
2: 0
3: 27
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001377012 Original CRISPR CTCTTCAGGGCTGATTTATA AGG (reversed) Intronic
902388401 1:16088907-16088929 CTCTTCACCTCTGATTTATGAGG + Intergenic
904672695 1:32178097-32178119 CTATCAAGGCCTGATTTATATGG + Intergenic
905372238 1:37489084-37489106 CTCCTCAGGCCTCTTTTATAAGG - Intergenic
906245204 1:44268557-44268579 CTCCTCAGGGCTGATCTGGATGG - Intronic
912586661 1:110772612-110772634 CTCTTCTGGAGTGCTTTATAAGG - Intergenic
913533338 1:119748700-119748722 CTCTACAGGGCTGATGCTTATGG + Exonic
915907340 1:159888445-159888467 CTCCTCAGGGCTGATGATTAGGG + Exonic
916634107 1:166649601-166649623 CTCTTGTTGGCTGATTTATATGG + Intergenic
918746001 1:188200633-188200655 TCCTTCAGGTCTCATTTATAAGG - Intergenic
921727345 1:218538426-218538448 TCCTTCAGGTCTGTTTTATAAGG - Intergenic
922863187 1:228837020-228837042 CTCTTAAGGACTGAATTATCAGG - Intergenic
1062924111 10:1301602-1301624 CTCTTCAGGGTTCATTAATTTGG + Intronic
1063268943 10:4485695-4485717 ATCATCTGGGCTGATTAATATGG + Intergenic
1065130278 10:22613269-22613291 CTGCACAGGGCTGATTTCTAAGG + Intronic
1066610439 10:37241727-37241749 ATTTTAAGTGCTGATTTATATGG + Intronic
1067229985 10:44399392-44399414 CTTTTCAAGGCTCATTAATAAGG + Intergenic
1070387292 10:75937308-75937330 CTCTTCAAGGCTTATCTAAAAGG - Intronic
1076413854 10:130271083-130271105 CTCTTGAGGGCTAGTTTCTAGGG + Intergenic
1077324613 11:1958354-1958376 CCCTTCAGTGTTGATTTAAAGGG + Intronic
1078814725 11:14808437-14808459 CACTTCAGGGATAATTTCTATGG - Intronic
1085926281 11:81026367-81026389 CTCTCCAGAGTTGATTAATATGG + Intergenic
1086089681 11:82993026-82993048 CTCTTCAGAGCTGGGTTTTATGG - Intronic
1088170453 11:106990418-106990440 CTCTTCAGGGATCATTTCTCTGG - Intronic
1089129539 11:116200961-116200983 CTCCTCAGGTGTGATTTAGAAGG - Intergenic
1202807592 11_KI270721v1_random:13531-13553 CCCTTCAGTGTTGATTTAAAGGG + Intergenic
1093109951 12:15139224-15139246 GACTTCAAGGCTTATTTATAAGG - Intronic
1093467314 12:19463197-19463219 CTTGTCAGAGCTGATTTAGATGG + Intronic
1094261874 12:28509732-28509754 CTCTTCAGCGCTGATGATTATGG + Intronic
1097014330 12:55974429-55974451 CTCTTCAGCGCTGCTTAATGAGG - Intronic
1101108545 12:101463125-101463147 CTCTTGAGGACTGGATTATATGG - Intergenic
1108188114 13:47908577-47908599 CTATTCAGGGCTGTCTGATAGGG - Intergenic
1108452391 13:50580203-50580225 ATCTTCAGAGCCTATTTATATGG - Intronic
1111311494 13:86493104-86493126 CTCTTCAGGTCTGTCTTATGAGG - Intergenic
1112331152 13:98477945-98477967 GTGTTCAGGGCAGATTTAAAAGG - Intronic
1114299385 14:21360792-21360814 CTCTTCAGGGCACATTTGTTAGG - Intronic
1114572545 14:23683264-23683286 CTCTTCAAAGATGTTTTATATGG - Intergenic
1115106912 14:29772305-29772327 TTCTTGAGGGCTCATTTATAGGG - Intronic
1118493090 14:66280726-66280748 CTCTGCAGGCCTGATTTAGATGG - Intergenic
1121599758 14:95194638-95194660 CTCTTCATGGCTCAGTTGTACGG + Intronic
1122065364 14:99169701-99169723 CTTTGCAGGGCTGAGTTACAAGG + Exonic
1124879920 15:33632523-33632545 TTATTCTGTGCTGATTTATAAGG + Intronic
1125215194 15:37264007-37264029 CTCTCTAGGGCCTATTTATAAGG - Intergenic
1127591477 15:60428623-60428645 TTCTTCACTCCTGATTTATAAGG - Exonic
1127886484 15:63205992-63206014 CTCTTCAGAGCTCTTTTATCTGG + Intronic
1128134691 15:65254194-65254216 CTTTTCAGGGCTGCAGTATATGG + Intronic
1129083105 15:73059054-73059076 AGCTTTAGGGCTGAGTTATATGG + Intronic
1130871691 15:87976938-87976960 CTCTTGAGAGCTGATATATGGGG - Intronic
1131842991 15:96458000-96458022 CTCTTCCTGGCTGACTAATAGGG + Intergenic
1132016191 15:98319567-98319589 TTCTCCAGGCCTGATTTATGAGG + Intergenic
1133388157 16:5387346-5387368 CTCTCCTGGACTTATTTATAAGG - Intergenic
1138713726 16:58998282-58998304 TTGTTCAGGGCTGATTTATATGG + Intergenic
1138858883 16:60730663-60730685 CTCTTCAGGGCTGTTGTCTCCGG + Intergenic
1144390152 17:14785558-14785580 GACTTAAGGGCAGATTTATAAGG - Intergenic
1144667784 17:17113481-17113503 CTTTTTATGGCTGAATTATATGG + Intronic
1163411944 19:17160475-17160497 CTCTTAAGGTCTAATCTATATGG - Intronic
1168440014 19:56356574-56356596 CCCCTCAGGGCTTAGTTATAAGG - Intronic
926223735 2:10953054-10953076 ATCTTCAGGGCTGTTATATTAGG - Intergenic
927710839 2:25324909-25324931 CTCTGCAAAGCTGATTTATCTGG + Intronic
929058670 2:37901117-37901139 CTCTCCAGGTCTCTTTTATAAGG + Intergenic
929138928 2:38650518-38650540 CTGTTCAGGGCTGGTATAGAGGG - Intergenic
930663925 2:54083263-54083285 CTCTTGAGGGCTAATCAATACGG + Intronic
930689228 2:54342196-54342218 CTCTTCAGGGCTTAGTTCTTTGG + Intronic
932323980 2:70842789-70842811 CTCTTCAGAGCTGTTAGATAGGG - Intergenic
937030815 2:118738822-118738844 CCCTTCAGCTCTGATTTACATGG + Intergenic
937251808 2:120528613-120528635 CTCTGCAGGGCTGATTTGAGAGG - Intergenic
941180540 2:162254131-162254153 CTCTCCAGGGCTGATCTGCATGG - Intergenic
941836156 2:170022936-170022958 CTCTTCATGGCTGATTTCTCAGG + Intronic
942614073 2:177771510-177771532 CTCTTTGGGTCTCATTTATAAGG + Intronic
942745186 2:179224069-179224091 CTCTTCAGAGTTTATTTTTAGGG - Intronic
944044737 2:195396503-195396525 CTATTCATGGCATATTTATAAGG + Intergenic
1171850853 20:30306941-30306963 CTCTCCAGGTCTCATTTATTGGG + Intergenic
1175048909 20:56134708-56134730 CTCTTCTGTGCTAATTTCTATGG + Intergenic
1175150939 20:56933729-56933751 GTGTTCAGGGATGAGTTATAGGG - Intergenic
1175275277 20:57764338-57764360 CTCATGAGATCTGATTTATAAGG - Intergenic
1175660975 20:60811744-60811766 CTCTTCTGGGCTGTTTTCTGAGG - Intergenic
1176676021 21:9778361-9778383 CTCTCCAGGGGTGATTTACAAGG - Intergenic
1177840118 21:26226537-26226559 CACTTTAAGGCTGATATATATGG + Intergenic
1178542271 21:33463349-33463371 CTCTTCAAAGCTGCTTTATTTGG + Intronic
1178904176 21:36623029-36623051 TTCCTCAGGACAGATTTATAGGG + Intergenic
1179149818 21:38800183-38800205 CTCCTCAGGCCTGATTCATAAGG - Intergenic
1181406997 22:22692177-22692199 CTCTTCATGGCTGAGTTAAGTGG + Intergenic
1181476417 22:23170433-23170455 CTCTTCAGGGTTCCTTTAAAAGG + Intergenic
1185241162 22:49748537-49748559 CCCTTCAGGGGTGATTTTCATGG + Intergenic
956467580 3:69534651-69534673 CTCTTTGGGGCTCATTTTTATGG + Intronic
957179151 3:76854157-76854179 CTTATGAGGGCTGATTTTTAAGG - Intronic
959345574 3:105190884-105190906 CTCTTCAGGGCTTGCTTATCAGG + Intergenic
961127962 3:124438209-124438231 CTCTTCTGAGTTCATTTATAAGG + Intronic
964463214 3:156960224-156960246 CTTTTCAGTGGTGATTTACAAGG - Intronic
965956214 3:174373098-174373120 TTCTTCAGTGTTGAGTTATACGG - Intergenic
966312105 3:178605202-178605224 CTCTTCAGAGCTCTTTTATAAGG - Intronic
966716645 3:183019432-183019454 CTCTTCAGGCCTCTTTCATAAGG - Intronic
968377910 4:59455-59477 CTCTTCAGGGGAGAATTCTATGG - Exonic
973061171 4:45727204-45727226 CTCTTCAAGGCTTATTTTAAAGG - Intergenic
974488953 4:62539299-62539321 TTCTTTAGGCCTGTTTTATAAGG + Intergenic
975249240 4:72158415-72158437 CTACTCAGGGCTAATTTATCAGG - Intergenic
976940781 4:90699850-90699872 CTCTGTAGGGTTTATTTATAAGG - Intronic
978002352 4:103572079-103572101 CTCTTCAGGGATGAGTCATGTGG + Intergenic
978016043 4:103748092-103748114 ATCTTAAGGGCTGATTTTGAGGG + Intergenic
980051424 4:128043888-128043910 CTCTGGAGGGCTGATTGAAAAGG - Intergenic
980620647 4:135298587-135298609 CTCTTCAGTGTTGATTTTGAGGG - Intergenic
981521841 4:145670762-145670784 CTCTGCAGGACTTATTTATTAGG + Intergenic
984282583 4:177689774-177689796 CTCTCATGGGCTGATTTATCTGG + Intergenic
985399515 4:189580385-189580407 CTCTCCAGGGGTGATTTACAAGG + Intergenic
992147979 5:73871468-73871490 CTCTCCATGGCTGATATTTAAGG + Intronic
992810775 5:80386319-80386341 CTCCTCAGGGCTCAGTTCTAAGG - Intergenic
992875271 5:81048036-81048058 CTCTAAAGGGCTGATTTTAAGGG - Intronic
993515905 5:88834633-88834655 ATCTATTGGGCTGATTTATAGGG + Intronic
993890875 5:93470917-93470939 CTCTTCAGGGCTAATTTCTATGG - Intergenic
998059331 5:139107025-139107047 CTCTGCAGGGCTGAGTGATCAGG - Intronic
999329461 5:150662672-150662694 CTCTTCAGGGGTGGTTTCTAGGG - Intronic
999354331 5:150910399-150910421 CCTTTCAGGTCTGATTTATTAGG - Intergenic
1001377012 5:171269577-171269599 CTCTTCAGGGCTGATTTATAAGG - Intronic
1007022671 6:38537916-38537938 TCCTTCAGGGGTGATTTACATGG - Intronic
1008367116 6:50694465-50694487 CTCTTCAGGGAAGATTTCTCTGG + Intergenic
1010751563 6:79621368-79621390 CTCTCCAGGTCTCTTTTATATGG - Intergenic
1010939764 6:81902763-81902785 CTCTTCAGCACTGAGTTTTAAGG - Intergenic
1015312904 6:131784286-131784308 CTCTTCAAGGCACATTGATATGG - Intergenic
1017478858 6:154829500-154829522 CTCTTCAGGTCTAATTTTTGAGG - Intronic
1020560217 7:9721786-9721808 GTCTGCACAGCTGATTTATAAGG + Intergenic
1035416711 7:158695451-158695473 TTCTTCAGGGTTGATTTTTCAGG - Intronic
1037781391 8:21871664-21871686 CTCTCCAGGCCTGATTTATGTGG - Intergenic
1039083682 8:33758981-33759003 CTCCTTAGGGCTCTTTTATAAGG + Intergenic
1041812125 8:61923253-61923275 CTTTTCAAGGCTGATTTATTTGG - Intergenic
1042759765 8:72257687-72257709 CTCTTCAGGCCCTATTTATCTGG - Intergenic
1043160587 8:76841607-76841629 CTTTCCAGGGTTAATTTATATGG + Intronic
1044630781 8:94276677-94276699 CTCATCGGGGCTTATTTATGTGG + Intergenic
1046801543 8:118434046-118434068 CTCTTCAGGGCTGATTTTTCTGG - Intronic
1047898691 8:129396506-129396528 CTCCTAAAGGCTGATTTAGAGGG + Intergenic
1048149767 8:131883278-131883300 CTCTTCAGGGCTGTCAGATAGGG + Intergenic
1049210342 8:141383634-141383656 CTCTTGGGAGCTGATTTATAAGG - Intergenic
1049335369 8:142081716-142081738 CCCTTCAGGGCTGAGGTATAGGG + Intergenic
1057558604 9:96109477-96109499 CACTGCTGGGCTGTTTTATAGGG - Intronic
1059391266 9:114001064-114001086 TTCATGAGGGCTGATTTAGATGG + Intronic
1059552739 9:115245924-115245946 GTCTTCAGGACTGATTTTGATGG - Intronic
1203571328 Un_KI270744v1:134792-134814 CTCTTCAGGGGAGAATTCTATGG + Intergenic
1186817230 X:13249888-13249910 CTCCTCAGGGCTGTTTCAGAGGG - Intergenic
1187900517 X:24023683-24023705 CTCTTCATTGCTGATTAATTTGG - Intronic
1189473835 X:41334243-41334265 CTCTTCAGGGATGAGTCATGTGG + Exonic
1192763566 X:74121002-74121024 CTCTTCAGGGATGAGTCATGTGG + Intergenic
1193241094 X:79170520-79170542 CTCTTCAGGGATGATTAACTTGG - Intergenic
1194163958 X:90490428-90490450 CTACTCAGGCCTGATATATATGG + Intergenic
1196224696 X:113152063-113152085 TTCTTCAGGCCTCTTTTATAAGG - Intergenic
1198329377 X:135607690-135607712 TCTGTCAGGGCTGATTTATATGG + Intergenic
1198521526 X:137458104-137458126 CTCTTCAAGGTTCATTCATATGG + Intergenic
1199435493 X:147807923-147807945 CTCTCCAAGGCTGCTTCATATGG - Intergenic
1200510219 Y:4068237-4068259 CTACTCAGGCCTGATATATATGG + Intergenic
1201323398 Y:12726977-12726999 CTGTTCAGGCATGAGTTATATGG - Intronic
1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG + Exonic
1202362597 Y:24127704-24127726 CTCGTGAGGACTGAATTATAGGG - Intergenic
1202508303 Y:25544721-25544743 CTCGTGAGGACTGAATTATAGGG - Intergenic