ID: 1001377816

View in Genome Browser
Species Human (GRCh38)
Location 5:171279463-171279485
Sequence CTTTATAAAAAGGTTGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 417}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001377816_1001377818 -3 Left 1001377816 5:171279463-171279485 CCAAACTCAACCTTTTTATAAAG 0: 1
1: 0
2: 4
3: 46
4: 417
Right 1001377818 5:171279483-171279505 AAGAACCAATCCCAGAATAATGG 0: 1
1: 0
2: 0
3: 23
4: 253
1001377816_1001377822 17 Left 1001377816 5:171279463-171279485 CCAAACTCAACCTTTTTATAAAG 0: 1
1: 0
2: 4
3: 46
4: 417
Right 1001377822 5:171279503-171279525 TGGCATTAATCCAAGCATGAAGG 0: 1
1: 4
2: 109
3: 415
4: 1192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001377816 Original CRISPR CTTTATAAAAAGGTTGAGTT TGG (reversed) Intronic
900080217 1:851205-851227 CTTTTTAAAAAGGTTGATGAGGG - Intergenic
900282418 1:1879387-1879409 CTTTATAAAAATGTTATGTATGG - Intronic
900670621 1:3851808-3851830 CTTTATTAAAATGTTCAATTGGG - Intronic
901311641 1:8273944-8273966 TTTTATAAAAAGGTTGTCCTGGG - Intergenic
902041939 1:13499020-13499042 CCTTATAAAAAGGGGGAATTTGG - Intronic
902124013 1:14193301-14193323 CTTTATAAAAAGGGGAAATTTGG + Intergenic
902814168 1:18906655-18906677 CTTTAGAACAAGGGTGAGTGAGG + Exonic
903792178 1:25901456-25901478 CTTTGTAAAAGGGTTGAGCTTGG - Intronic
907097737 1:51796884-51796906 CTTTTAAAAATGGTTGAGATTGG - Intronic
908037327 1:60069914-60069936 CTTTATAAAAAGGGGCAATTTGG + Intronic
908505007 1:64788169-64788191 CTTTATAAAAAAGAAGATTTTGG + Intronic
909404987 1:75278453-75278475 TATTATAAAAAGGATGTGTTGGG - Intronic
909505243 1:76380835-76380857 CATTATAGAAAGGTTCAGTATGG - Intronic
909832362 1:80208779-80208801 CTTTTTAAAAAGTTTTAGTTTGG - Intergenic
910944334 1:92572939-92572961 CTTCAGAAAAAGTTTGATTTGGG - Intronic
911962047 1:104317848-104317870 TTTTATAAAAAGGTTGAAAATGG - Intergenic
912140637 1:106721649-106721671 CTTTCTAAAAAGGAAGAGGTTGG - Intergenic
912318500 1:108688541-108688563 TTTTCTAAAAAGGTATAGTTTGG - Intergenic
915437840 1:155922443-155922465 CCTTATTAAAATGTTGAGGTGGG - Intronic
915852424 1:159339808-159339830 CTTGATAAAAAGGATGAATGTGG - Intergenic
917349812 1:174065107-174065129 CTTTGGAAAAAGGTTAAGGTGGG + Intergenic
918970833 1:191416864-191416886 CTTTTTATAAAGGATTAGTTTGG + Intergenic
919930193 1:202216205-202216227 CTTCAGTAAATGGTTGAGTTGGG + Intronic
920874387 1:209820729-209820751 CTTTTTAAAAAAATTCAGTTAGG - Intergenic
921588621 1:216977888-216977910 CCTGATAAAAAGGGTGAGTTTGG + Intronic
921922543 1:220685685-220685707 TTTTAAAAAAAGGTTGAATGAGG + Intergenic
922506543 1:226129331-226129353 CTTGATAAAAAGGATGATTCTGG + Intergenic
922912415 1:229228801-229228823 CTTTTTAAAAATGTTGACTTTGG - Intergenic
923001031 1:230006563-230006585 CCTTATAAAAAGGGGGAATTTGG - Intergenic
923142996 1:231177058-231177080 CTTTAAAAGAAGGCTGATTTTGG + Intronic
923632918 1:235665852-235665874 CTTTATAAACAGGATGGTTTGGG + Intronic
1063704670 10:8419421-8419443 CTACAGAAAAAAGTTGAGTTGGG + Intergenic
1065221038 10:23496260-23496282 GCTTTTGAAAAGGTTGAGTTTGG + Intergenic
1065222854 10:23513865-23513887 ATTTATAAGAAGTTTGAGTTGGG + Intergenic
1065302322 10:24334128-24334150 ATTTATAAAATATTTGAGTTTGG + Intronic
1066017421 10:31261772-31261794 ATTTATAAAACTGTTGATTTTGG - Intergenic
1066202246 10:33152912-33152934 CTTTATCAAAGGGTAGAGGTTGG + Intergenic
1067412025 10:46073303-46073325 TTTTATAAAAAAGTTGTGGTAGG - Intergenic
1068259074 10:54554820-54554842 CTTTTTCAAAATGTTCAGTTAGG - Intronic
1068501384 10:57843001-57843023 CTTTATAAAAAGGGGAAATTTGG - Intergenic
1068618750 10:59153777-59153799 CTTTATAAAAAGGGAAAATTTGG - Intergenic
1069105072 10:64373797-64373819 CTTTTTAAAAAAGTAGAATTTGG + Intergenic
1069407232 10:68114654-68114676 CTTTCTGAAAATGTTGAGTCAGG - Intronic
1070992053 10:80741156-80741178 CTTTAGAAAGATTTTGAGTTTGG - Intergenic
1072780653 10:98249073-98249095 CTTGATATAAAGGATGAGCTGGG - Intronic
1073551234 10:104403618-104403640 TTATATAAAAAGTTGGAGTTAGG - Intronic
1073763870 10:106660610-106660632 ATTTTTAAAAAGTTTAAGTTAGG - Intronic
1074321786 10:112410171-112410193 CTTTCAAAAAAGATTTAGTTAGG + Intronic
1075349121 10:121708373-121708395 CTTTATAAAAAGAGAAAGTTTGG - Intergenic
1076160470 10:128240664-128240686 TTCTATAAGAAGGTTCAGTTTGG + Intergenic
1076308575 10:129484798-129484820 TTTTAAAAAAAGGTTTTGTTAGG + Intronic
1076626045 10:131822661-131822683 CTTGATAAAAAGACTGAGCTCGG + Intergenic
1077572852 11:3354589-3354611 CTTTATAAAGGGGGTGAGCTAGG + Intronic
1078568590 11:12438422-12438444 CCTGATAAAAAGGATGAGTTTGG - Intronic
1078776089 11:14394692-14394714 CTTTAAGAAAAGGATGAGCTTGG + Intergenic
1079223457 11:18585060-18585082 CTTTTTAAAAAAATTGAGATAGG + Intronic
1079478803 11:20859254-20859276 ATTTATAACAAGGTGGATTTTGG - Intronic
1079896516 11:26126225-26126247 CTGTCCAAAAAGGGTGAGTTTGG - Intergenic
1080317891 11:30970766-30970788 CCTGATGAAAAGGTTGAGTTGGG - Intronic
1080450129 11:32372301-32372323 CTTTCAAAAAAGGTTTATTTTGG - Intergenic
1081314108 11:41610829-41610851 CCTTATAAAAAGGTGAAATTTGG - Intergenic
1082633280 11:55565956-55565978 CTTTATAAAAACTTTGTATTCGG - Intergenic
1083077111 11:60052250-60052272 CTTTAAAAAATGTTTGTGTTGGG + Intergenic
1083139051 11:60706526-60706548 CTTTATATCAAGATTCAGTTAGG - Intronic
1083170043 11:60918438-60918460 CCTGATAAAAAGGATGACTTTGG - Intronic
1085909945 11:80811436-80811458 CTTTATAAAAAGGGTTAGCAGGG - Intergenic
1086466289 11:87057206-87057228 TTTTATATAAAAGTTGAGATAGG - Intronic
1086808494 11:91273634-91273656 ATTTTTAAAAAGGTTTATTTTGG - Intergenic
1086839126 11:91663622-91663644 CTTTATGATTAGGTTTAGTTCGG - Intergenic
1086980762 11:93195847-93195869 TTTTATAAAATGGTTGGGATGGG - Intronic
1087537921 11:99475214-99475236 CCTTATAAGATGGATGAGTTTGG + Intronic
1087549551 11:99630988-99631010 CATCATAAAAAGGTAGAGTTAGG + Intronic
1087988621 11:104717872-104717894 TTTTAATAAAAGGTTGAATTTGG - Intergenic
1088531439 11:110814668-110814690 GTATATGAAAAGGTTGACTTTGG + Intergenic
1089798617 11:121004707-121004729 TGTTATAAAATGGTAGAGTTGGG - Intergenic
1090073790 11:123566387-123566409 CTTTTTAAAAAGGCAGATTTGGG + Intronic
1090686196 11:129123456-129123478 CATTATGAGAATGTTGAGTTCGG - Exonic
1091478087 12:797430-797452 TTTTATAAAAAGGTAGATTTTGG + Intronic
1093045731 12:14441980-14442002 CTTGATTAAAAGGTAGAGATTGG - Intronic
1093063816 12:14635220-14635242 CTTTATAAATATGTTGAGACTGG - Intronic
1094182645 12:27608581-27608603 CCTTAAAAAATGGGTGAGTTAGG + Intronic
1094292684 12:28869972-28869994 CTTTATAAAAAGGAGAAATTTGG - Intergenic
1094499896 12:31012058-31012080 TTTTATAAAGAGGCTGTGTTAGG - Intergenic
1095426709 12:42082436-42082458 TTTTATAAAAAGGTTGAAAATGG + Exonic
1095498261 12:42808424-42808446 CTTTAGAGAAAGTTAGAGTTTGG + Intergenic
1095526919 12:43137687-43137709 CTTTAAAAAAAGAGTGTGTTTGG + Intergenic
1095700854 12:45189569-45189591 CTTTAAAAAAAGGCAGAGGTTGG - Intergenic
1096186370 12:49584300-49584322 TTTTATTAAAATGTAGAGTTTGG + Intronic
1097399318 12:59109911-59109933 CTTCATAAAAAAGCTGAGTCGGG + Intergenic
1097836574 12:64279213-64279235 TTTTACAAAATGGTGGAGTTGGG - Intronic
1098388813 12:69947443-69947465 CTTAATAAAAAGTTTGGGTAAGG + Intronic
1099318057 12:81109243-81109265 CTATGTAAAAAGGCTGATTTTGG + Intronic
1099665607 12:85624873-85624895 CATTATGAAAAGGATGAATTTGG - Intergenic
1100027676 12:90149996-90150018 CTGTATAAAGAGGTTGATTTGGG + Intergenic
1100412307 12:94332040-94332062 CTTTACAAAAATCCTGAGTTAGG + Intronic
1100477647 12:94949014-94949036 GTTTAAAGGAAGGTTGAGTTGGG + Intronic
1101121952 12:101591232-101591254 CTATTAAAAAAGATTGAGTTAGG + Intronic
1101385851 12:104256853-104256875 TTTTATCAAAATGTTGAATTTGG + Intronic
1103173920 12:118845161-118845183 CCTTATAAAAAAGTGGAGATTGG + Intergenic
1104252064 12:127104622-127104644 CCTTATAAAAAGGGGGAATTTGG - Intergenic
1105067876 12:133216190-133216212 CCTTATAAAAAGGGGGAATTTGG + Intergenic
1105488651 13:20864044-20864066 CTTTAAAAAAAGGTTCAAATTGG - Intronic
1105537132 13:21277436-21277458 CTTACTAAAAAGGATGAGATGGG - Intergenic
1106937519 13:34739513-34739535 CTTTTTAAAAAGGGGGAGATGGG + Intergenic
1106964415 13:35043863-35043885 ATTAATAAAAAGGTTAGGTTAGG - Intronic
1107243326 13:38264286-38264308 ATATATAAAAAGGTTAACTTTGG + Intergenic
1107270474 13:38610341-38610363 CCTGATAAAAAGGATGAGTTTGG - Intergenic
1108185659 13:47886050-47886072 CTTTAAAAAAAAATGGAGTTAGG + Intergenic
1108236146 13:48407761-48407783 CTTTTTAAAAAGTTTGTTTTTGG + Intronic
1108244417 13:48500256-48500278 CTTTATAAAAAGGGGAAATTTGG + Intronic
1109075483 13:57829317-57829339 CTTTATAGAAAGGTGAAGTTTGG - Intergenic
1109142903 13:58737719-58737741 CCTTATAAAAAAGAGGAGTTTGG + Intergenic
1110452920 13:75657036-75657058 CTTTATAAAAAGGGTAGATTTGG + Intronic
1111285089 13:86080225-86080247 CTTTTTAAAAAAATTGACTTTGG - Intergenic
1111302595 13:86365221-86365243 CTTAATAAAAAGATGAAGTTTGG + Intergenic
1111317959 13:86585680-86585702 CTTTATAAAAACCCAGAGTTAGG + Intergenic
1111517436 13:89352910-89352932 TGTTATAGAAAGGTTTAGTTTGG - Intergenic
1111840429 13:93442849-93442871 CTTTCTAAATAGGTATAGTTAGG - Intronic
1112271261 13:97972532-97972554 CTTTACGAAAAGGGTGAGGTTGG - Intronic
1112455162 13:99553980-99554002 GTTAATAAAAAGGTAGAGTTAGG - Intronic
1112767533 13:102761952-102761974 CTTAATGAGAAGGTAGAGTTCGG + Intergenic
1113613505 13:111664698-111664720 CCTTATAAAAAGAGGGAGTTTGG + Intronic
1114161956 14:20178187-20178209 CTTCTTAAAAAGATTGAGATAGG - Intergenic
1115201365 14:30857439-30857461 CCTTATAATAAGGTTGGGTAAGG + Intergenic
1115741875 14:36397567-36397589 CATTACAAAAAGGTGGAATTTGG - Intergenic
1116221107 14:42088463-42088485 CAATATAAAAAGTTAGAGTTAGG + Intergenic
1116266685 14:42700639-42700661 CTTTATAAGAAGGTAAAATTTGG - Intergenic
1116823313 14:49646772-49646794 CTTGTTAAAAATGTTAAGTTAGG - Intronic
1117098721 14:52323542-52323564 CTTTAAAAATAGGTTGGGTGCGG - Intronic
1117578268 14:57123693-57123715 ATTTATAAAAATGTTTATTTTGG + Intergenic
1117775624 14:59181130-59181152 CTTTATAAAAAGGGTAAATTTGG + Intergenic
1117895687 14:60484358-60484380 CGTTCTGAAAAGGTAGAGTTTGG - Intronic
1118169173 14:63369278-63369300 ATTTAATAAAAGGGTGAGTTTGG - Intergenic
1119372598 14:74160158-74160180 CTTTATACAAAGGAAAAGTTTGG + Intronic
1119556498 14:75557468-75557490 CCTGATAAAAAGGTGGAGTTTGG - Intergenic
1119560056 14:75582798-75582820 GTTTATAAAATGGTTTAGTCAGG + Intronic
1120164705 14:81184526-81184548 ACTAATAAAAAGGTGGAGTTAGG - Intronic
1120353321 14:83393169-83393191 CTTTATAAAATCGTTGCCTTAGG + Intergenic
1123828983 15:24114276-24114298 CTATATATAAAGATTGATTTTGG + Intergenic
1123843903 15:24277711-24277733 CTATATATAAAGATTGATTTGGG + Intergenic
1123858979 15:24443991-24444013 CTATATATAAAGATTGATTTTGG + Intergenic
1123863614 15:24494378-24494400 CTATATATAAAGATTGATTTTGG + Intergenic
1125844578 15:42839797-42839819 CCTGATAAAAAGGATGAGCTGGG + Intronic
1125917891 15:43505717-43505739 ATATCTAAAAAGGTTGAGATGGG - Intronic
1126140895 15:45437761-45437783 CTTTCTTAAAACATTGAGTTTGG - Intronic
1126345019 15:47684444-47684466 TCTTTTAAAAAGGTTGAGATAGG + Intronic
1128037824 15:64541985-64542007 TTTAAAAAATAGGTTGAGTTGGG + Intronic
1129025702 15:72571732-72571754 CTTTCTCAAAAAGTTGAGTTAGG + Intronic
1129497308 15:75996940-75996962 CTTTGTAAAAAGGATGAGGTAGG + Intronic
1130555491 15:84919632-84919654 CCTGATAAAAAGGATAAGTTTGG - Intronic
1132216313 15:100064111-100064133 CCTTATAAAAAGGGGAAGTTTGG + Intronic
1133834371 16:9352929-9352951 CTTTAAAAAAATGTTAAGTTGGG + Intergenic
1135650305 16:24200736-24200758 CCTAATAAAAGGGATGAGTTTGG - Intronic
1135795898 16:25442224-25442246 CTTTGTAAAAGGGGTGTGTTGGG + Intergenic
1136273564 16:29164145-29164167 CTTTTTAAAAAGTTCCAGTTGGG + Intergenic
1138620072 16:58204034-58204056 CTTTATAATAAGCTTGATCTTGG + Intergenic
1140377810 16:74459176-74459198 CTTTTTTAAAAGGTTAATTTTGG + Intronic
1140398895 16:74653520-74653542 ATTTAAAAAATGGCTGAGTTTGG + Intronic
1141130344 16:81432194-81432216 CCTTATAAAAAGGGGAAGTTTGG + Intergenic
1141857790 16:86696064-86696086 CTTTGGAACAAGATTGAGTTTGG - Intergenic
1143366983 17:6414852-6414874 CCTTATAAAAAGAAGGAGTTTGG + Intronic
1145016857 17:19404635-19404657 CTTTTATAAAAGGATGAGTTTGG + Intergenic
1148987401 17:51635159-51635181 CTTTATAAAAAGGGGAAATTTGG + Intronic
1149248425 17:54739142-54739164 CTTAATAAAAAGGTGTAGTGGGG + Intergenic
1150064125 17:62094634-62094656 CTTTACAAAAAAATTGAATTAGG + Intergenic
1150093444 17:62351033-62351055 TATTATAAAAAGGTTTACTTGGG - Intergenic
1150967184 17:69984670-69984692 CTGGATAAAAAGGATGAGTTTGG - Intergenic
1152102257 17:78308968-78308990 CTCTAAAAAAAGGTTGGGTGTGG - Intergenic
1153114362 18:1636448-1636470 CATATAAAAAAGGTTGAGTTCGG - Intergenic
1153259062 18:3204806-3204828 CTTTATAAAAAGTTTGAAACTGG - Intronic
1153373489 18:4348611-4348633 CTTCACAGAAAGGTTGATTTTGG + Intronic
1154226372 18:12508292-12508314 TTTTAAAAAAATGTTGGGTTTGG + Intronic
1155409128 18:25522846-25522868 CCTTATAAAAAGGGGCAGTTTGG + Intergenic
1155601667 18:27555951-27555973 CTTTAAAAAAATCTTTAGTTGGG + Intergenic
1156016453 18:32552333-32552355 CAATATAAAAAGGTTGGATTAGG - Intergenic
1156286515 18:35701495-35701517 CCTCATAAATAGGTTGTGTTAGG - Intronic
1156612265 18:38738759-38738781 TTTTAATAAAAGGATGAGTTCGG - Intergenic
1156757833 18:40550113-40550135 CTGTAGAAAAATGTAGAGTTGGG + Intergenic
1156998078 18:43492840-43492862 CTTAATAAATAGGTAGAGTTTGG + Intergenic
1157340729 18:46775956-46775978 CCTCAAAAAAAGGATGAGTTTGG + Intergenic
1157371544 18:47117405-47117427 CCTGATCAAAAGGATGAGTTTGG + Intronic
1158189781 18:54813676-54813698 ATTTATAAACAGGTTTATTTTGG - Intronic
1158348662 18:56541623-56541645 TTATATAAACAGGTTGATTTAGG - Intergenic
1158365270 18:56727315-56727337 TTTTAAAAACAGGTTTAGTTGGG + Intronic
1158767011 18:60463470-60463492 TTTTAAAAAAAGTTTTAGTTTGG + Intergenic
1158966214 18:62624431-62624453 CCTGATTAAAAGGATGAGTTTGG - Intergenic
1159182551 18:64927497-64927519 GTAGATAAAAAGGTTGAGGTTGG + Intergenic
1159226713 18:65547508-65547530 CTTTATAAAAAGGGCCAGTTTGG - Intergenic
1159595501 18:70378940-70378962 CTTTTTAAAAAGATCGAATTTGG + Intergenic
1159877634 18:73829852-73829874 CTTTATAAGAAGGTTCAATGAGG - Intergenic
1162456991 19:10791386-10791408 CCTTATAAAAAGGGGGAGTTGGG - Intronic
1164187115 19:22880167-22880189 CTTTATGAAAAGGCTGAGAGAGG + Intergenic
1166973917 19:46592148-46592170 CTTTATAAAAAGGTGGATGCTGG - Intronic
1167965046 19:53137391-53137413 CTTTAATAAAAGGGTGGGTTGGG - Intronic
1168095635 19:54113266-54113288 CCTTATAAAAAGGGTAAATTGGG + Intronic
1168644724 19:58052697-58052719 CTTTGTTAATGGGTTGAGTTGGG + Intronic
925587456 2:5477293-5477315 GTTTATAAAAAGCTTTAGTCTGG - Intergenic
926122226 2:10249096-10249118 CTTTATAATAAGTTTGAAATTGG + Intergenic
926363220 2:12109798-12109820 CCTTATACAAAGGTGGAATTTGG - Intergenic
926708103 2:15850908-15850930 CCTTATAAAAAGGGGGAATTTGG + Intergenic
926851514 2:17203292-17203314 CTTCACAAAAAGGATGAGTTTGG - Intergenic
927556356 2:24036202-24036224 CTTTAAAAAAATGTAGGGTTGGG + Intronic
929408022 2:41665597-41665619 CCTGATAAAAAAGATGAGTTTGG - Intergenic
930171253 2:48253971-48253993 CATTATAAAAAAGTTGATTAAGG - Intergenic
930285620 2:49424087-49424109 CCTTATAAAAAGGGGGAATTTGG + Intergenic
930397248 2:50838596-50838618 CTTTATAAAAAGGTGAAATTTGG + Intronic
931593929 2:63919536-63919558 TTTTATACAAATGATGAGTTGGG - Intronic
931636147 2:64342152-64342174 CCTTATAAAAAGGGGAAGTTTGG + Intergenic
932178613 2:69625060-69625082 CATTCTATAAAGGTTGAGTTTGG - Intronic
932428861 2:71661389-71661411 CTTTAAAAAAAAGTCTAGTTTGG - Intronic
932628280 2:73316465-73316487 CTTTATAAAAAGGAAAAATTTGG - Intergenic
933124730 2:78590459-78590481 CCTTATAAAAAGGGGAAGTTTGG + Intergenic
933390010 2:81656455-81656477 CTTTAGAAAGAGTTTGGGTTTGG + Intergenic
934029919 2:88034299-88034321 CTTTGTAACAAGATTGTGTTTGG - Intronic
935468202 2:103424986-103425008 CCTTATAAAAAGGTGAAATTTGG + Intergenic
935950346 2:108323237-108323259 CTATATAAAAAGGCAGAATTTGG - Intergenic
936279475 2:111124588-111124610 CTTTGTAAAAATGTTGATGTGGG - Intronic
936375410 2:111937141-111937163 CTTTATAAAAATGTTAAGTTGGG + Intronic
936394778 2:112116696-112116718 TTTTTTAAAAAGGGTGGGTTGGG - Exonic
936973725 2:118198857-118198879 CTTTATAAAAAGGCAAACTTTGG - Intergenic
937031956 2:118748063-118748085 GTTTATAAAAAGGCAGAGTTTGG + Intergenic
938128648 2:128692428-128692450 CTCTTTAAAAAGATGGAGTTAGG + Intergenic
939105275 2:137941641-137941663 CTTTTTAAAAAGGAAGAGATTGG - Intergenic
939841494 2:147194562-147194584 CTTGATAAAAACATTGAGTTTGG - Intergenic
939872803 2:147543536-147543558 CTTTATACAAAGGATGAGTTTGG + Intergenic
940182263 2:150947739-150947761 CTTGGTAAAAAGGTGGAGTTAGG - Intergenic
940201806 2:151159727-151159749 CTTTATAAAGACATTTAGTTTGG - Intergenic
940636877 2:156308338-156308360 CCTGATAAAAAGGATGAGTTTGG - Intergenic
941635869 2:167934428-167934450 TTTTATAAAAAGGGTAAATTTGG + Intergenic
942164491 2:173228806-173228828 TTTCAAAAAAAAGTTGAGTTTGG - Intronic
942226775 2:173823440-173823462 CTTTATAAAAAGGAGACGTTTGG - Intergenic
943536963 2:189164805-189164827 CTTTATAAACATGATGTGTTGGG - Intronic
943590148 2:189786261-189786283 CTTTATAAAAATTTTAAGTGGGG + Intronic
944036756 2:195303605-195303627 CTTTACAAAAAGGGGAAGTTTGG - Intergenic
944447825 2:199809221-199809243 TCCTATAAAAAGATTGAGTTCGG + Intronic
944806061 2:203282323-203282345 TTTTAAAAAAAGGTTGAATAAGG - Intronic
945964666 2:216173755-216173777 AGTTATAAAAAGGATGAGTTCGG + Intronic
946592854 2:221270495-221270517 TTTTAAAAAAAGTTTGAGGTTGG - Intergenic
947898426 2:233697601-233697623 CCTTCTACAAAGTTTGAGTTTGG + Intronic
1168835998 20:877868-877890 CTCTGTAAAAAGGCTGACTTGGG + Intronic
1169432250 20:5547913-5547935 TCTTATGAAAAGGTTGAGTCAGG - Intronic
1169520895 20:6371927-6371949 CTTTATAAAAAGGGGGCATTTGG + Intergenic
1170971581 20:21121934-21121956 CTTCATAAAAAGGCAGAATTTGG + Intergenic
1172372926 20:34409481-34409503 CTTGAGAAAAAGGCTGAGATGGG - Intronic
1173063856 20:39690457-39690479 CTTTATAAAAAGCAGAAGTTTGG - Intergenic
1174492932 20:50915482-50915504 TTTTAGAAAAAGATTGAGTGGGG - Intronic
1176208355 20:63903605-63903627 CCTTATTAAAAGTTTGAGATGGG - Intronic
1177924189 21:27193629-27193651 TTTTATAAAAAAGGTAAGTTTGG - Intergenic
1178666095 21:34547706-34547728 CCTGATAAAAAGGATGAGTTTGG + Intronic
1179153980 21:38833596-38833618 CCTTATAAAAAGGGGGAATTTGG - Intergenic
1179302457 21:40124597-40124619 CCTTATAAAAAGGGCCAGTTTGG + Intronic
1179332700 21:40420699-40420721 CTTTATACAAAGGGGGAATTTGG + Intronic
1182959645 22:34460161-34460183 CTTAATAAAAGAGTTGGGTTGGG - Intergenic
1183918001 22:41138666-41138688 CATCATAAAAAGGTAGAGCTTGG + Intronic
1185321752 22:50204171-50204193 ATTTAAAAAAAGGTTGACCTGGG + Intronic
949449470 3:4169371-4169393 CTTTATAAAAAGGGGAAATTTGG + Intronic
950279928 3:11698079-11698101 GTTTACAAAATGGTTAAGTTTGG - Intronic
950847771 3:16031461-16031483 CTTAATAAAAAGGAGGAGGTAGG + Intergenic
951004494 3:17600844-17600866 TTTTAAAAAAAGATTGACTTTGG - Intronic
951008329 3:17646110-17646132 CTTTATAAGAAGGGTAAATTTGG + Intronic
951323403 3:21274150-21274172 CTTTATAAAATGACTTAGTTTGG - Intergenic
951830963 3:26926774-26926796 ATTAATAAAAAGCATGAGTTTGG - Intergenic
952411348 3:33052654-33052676 ATTCATACAAAGGTTGAATTTGG - Intronic
953600251 3:44356224-44356246 CATTATAAAAAGCTTAGGTTGGG + Intronic
954351523 3:50048137-50048159 CTTTATAAAATGTTTCAGCTTGG + Intronic
954353904 3:50068973-50068995 CTTTTTTAAAAGGTGGTGTTAGG + Intronic
955050974 3:55410542-55410564 ATTTATAAAAATGTTAAGTGGGG + Intergenic
955130096 3:56157576-56157598 CTTTAGGAAAAGATTGAGTGAGG + Intronic
955338741 3:58108394-58108416 CTTTGTATAAGGGTTTAGTTGGG + Intronic
955638190 3:61053356-61053378 CTTTTTAAAAAAATTGTGTTCGG + Intronic
956733342 3:72216848-72216870 CCTGATAAAAAGAATGAGTTTGG - Intergenic
956834174 3:73082122-73082144 CTTTATATACAGTTTGATTTTGG - Intergenic
957196042 3:77070011-77070033 CCTTATAAAAAGGGAGAATTTGG + Intronic
957995984 3:87690812-87690834 CTTTATAAACAGGAGAAGTTTGG + Intergenic
958011809 3:87888762-87888784 CTTTACAAAAACCTTGAGGTAGG - Intergenic
958055172 3:88401000-88401022 TAGTATAAATAGGTTGAGTTAGG + Intergenic
960007431 3:112794448-112794470 CTTGAGAAAAATCTTGAGTTTGG + Intronic
964000105 3:151760922-151760944 CTTTATAAAAAGGGAAAATTGGG - Intronic
965318631 3:167223556-167223578 CTTTATAAAATCATTGAGTTGGG + Intergenic
965465041 3:169018696-169018718 CCTGATAAAAAGAATGAGTTTGG + Intergenic
965676572 3:171203627-171203649 CATGATAAATATGTTGAGTTTGG - Intronic
965685349 3:171296370-171296392 ATTTTTAAAAAGGGTGTGTTGGG - Intronic
966167819 3:177040956-177040978 CTTTGTTAAAAGGTTGATTGAGG - Intronic
966391790 3:179460655-179460677 ATTAAAAAAAAGGTTGATTTAGG - Intergenic
966587081 3:181638343-181638365 CCTTCTAAAAAGGGTGAATTTGG - Intergenic
966873994 3:184311083-184311105 CTGTATAAAAAGGTTGAAACAGG + Intronic
970083422 4:12316495-12316517 CATTATAAAATTATTGAGTTTGG + Intergenic
970461895 4:16283048-16283070 CTTTATAAAAAGGAGAAATTTGG + Intergenic
971306757 4:25489600-25489622 CTTAAGTAAGAGGTTGAGTTTGG + Intergenic
971347797 4:25827349-25827371 CTTTATAAAAAAGTGAAATTTGG + Intronic
971906776 4:32736311-32736333 CTTTATAACAAGTTGAAGTTAGG - Intergenic
971933437 4:33116857-33116879 ATTTATAAACAGGTTTATTTTGG + Intergenic
972053620 4:34772171-34772193 ATTTATTAAAACATTGAGTTAGG - Intergenic
972228916 4:37047714-37047736 CTTCATAAAAAGGATGATTTTGG + Intergenic
972554973 4:40172492-40172514 CCTTATAAAAAGGAGGAATTTGG + Intergenic
972872415 4:43316042-43316064 CTTTATAAAAAGGAGGAATTTGG + Intergenic
974483207 4:62472506-62472528 CTTTATGAGAAGGTTCTGTTTGG + Intergenic
975337743 4:73200136-73200158 CTTTATAAAAAATTTCAGATGGG - Intronic
975496190 4:75038284-75038306 CTTTGTAACAATCTTGAGTTAGG - Intronic
976049682 4:80997025-80997047 CTTTAGAAAGAGGCAGAGTTTGG + Intergenic
976594548 4:86882710-86882732 CATTAAAATAAGGTGGAGTTTGG - Intronic
978145179 4:105364470-105364492 ATTTATAAAGAGGTTTATTTTGG + Intergenic
978310667 4:107382058-107382080 CTTTAGAAAGATTTTGAGTTTGG - Intergenic
978480661 4:109186511-109186533 CTTTAAAAAAAAGTTGTGTTGGG - Intronic
979524425 4:121702429-121702451 CCTGATAAAAAGGATGAATTTGG - Intergenic
979861227 4:125696186-125696208 ATTTATAAAAAGGTATAGTAAGG - Intergenic
980533895 4:134090087-134090109 CATTAAGAAAAGGTGGAGTTGGG - Intergenic
980593170 4:134917966-134917988 ATTTATAAAAAGGTACACTTTGG + Intergenic
980677730 4:136110784-136110806 CTTTATAAAAATCTTAAATTTGG - Intergenic
980745938 4:137015753-137015775 CTTTATAAAAATGTTCCATTAGG + Intergenic
980968346 4:139545536-139545558 CTTTACAAAAAGGTGGGGTTGGG + Intronic
981945188 4:150334118-150334140 CTTTTTAAATAATTTGAGTTAGG - Intronic
982158528 4:152544056-152544078 CTTTATAAAAATATTAAGGTAGG + Intergenic
982688478 4:158521411-158521433 GTTTATAAACTGTTTGAGTTTGG - Intronic
982977744 4:162088284-162088306 CTGTATAAAAAAGATGAGTGGGG - Intronic
983433568 4:167682601-167682623 CTTTATAAAAAGGGAAAATTTGG + Intergenic
984034583 4:174649521-174649543 CTTCCTAAAAAGGACGAGTTAGG - Intronic
984152192 4:176147163-176147185 CTTTATATAAAGTTTCATTTCGG - Intronic
984589590 4:181602103-181602125 CTTTATAAAAAGGTTATTATAGG - Intergenic
984897312 4:184553146-184553168 CTTTAAAAAAAAATTGAGATGGG + Intergenic
985045194 4:185933644-185933666 GTTTATAAAAAGGGGAAGTTTGG - Intronic
985124658 4:186681182-186681204 ATTTATTAAAATGCTGAGTTGGG - Intronic
986625853 5:9723401-9723423 CTTTATAAAAATGTGCTGTTGGG - Intergenic
986635083 5:9813125-9813147 CTTTATAAAAAGGGGGAAATTGG + Intergenic
986744985 5:10736030-10736052 CTTTATAAAAAGGGGAAGTTTGG + Intronic
986783947 5:11093795-11093817 AATTATTAAAAGATTGAGTTAGG - Intronic
986863841 5:11961092-11961114 TTTTATTAAAATGTTTAGTTTGG + Intergenic
987581125 5:19793909-19793931 CTGTATAAAAATGGTAAGTTTGG + Intronic
987690578 5:21261708-21261730 GTTTAAAAAATGGTTGAGGTCGG + Intergenic
987863522 5:23513414-23513436 CCTGATGAAAAGGATGAGTTGGG + Intronic
988258579 5:28852213-28852235 CTTTATAAGAAGGAGAAGTTGGG + Intergenic
988503955 5:31805829-31805851 CTTTATAAAAAGGGCAAATTCGG + Intronic
988978777 5:36542960-36542982 TTTTATAAAAAGGTTTTATTTGG + Intergenic
989287034 5:39713173-39713195 CTTTAAAAAAAGGTTTATTCAGG - Intergenic
992821530 5:80502198-80502220 CTTTATAAAAATGTTCAGCCTGG - Intronic
992908351 5:81370514-81370536 CTTTATAAAAAGGGGAAATTTGG + Intronic
993386727 5:87269865-87269887 CTTGATGAAAATGTTGAGATGGG + Intronic
993591149 5:89796592-89796614 CTTGATAAAAAGGATGAGTTTGG + Intergenic
993676862 5:90825832-90825854 CATTATCAAAAGTTTCAGTTAGG + Intronic
993875133 5:93297682-93297704 ATTTATTACAGGGTTGAGTTAGG + Intergenic
994049276 5:95344237-95344259 CTTAATAAAAAGGGGGAATTTGG - Intergenic
994053506 5:95389528-95389550 CCTGATAGAAAGGATGAGTTTGG - Intergenic
994219829 5:97182951-97182973 ATTTTTAAAAAGGTTTTGTTTGG - Intronic
994276861 5:97849187-97849209 TTTTAGAAAAATGATGAGTTGGG + Intergenic
994731148 5:103492158-103492180 TTTAATAAAAAGTTTGATTTAGG + Intergenic
995296429 5:110529545-110529567 CTCTATAAAAATGTTCTGTTTGG - Intronic
995898249 5:117039949-117039971 CTTGAAAACAAGGTAGAGTTAGG + Intergenic
996033299 5:118730728-118730750 TTTAATAAAAGGGTTCAGTTAGG + Intergenic
996760402 5:126980858-126980880 CTCTATAACAAGGTTTAGTGAGG + Intronic
997875936 5:137546911-137546933 CTTTATCAAAATGTTAAGTTTGG - Intronic
998223403 5:140306590-140306612 CTTTATAAAAAGGGGAACTTTGG + Intergenic
998493448 5:142566586-142566608 GTTTATAAAAAGATAGAGGTTGG + Intergenic
999141482 5:149365317-149365339 TTTTGTAAACATGTTGAGTTTGG - Intronic
999543743 5:152603781-152603803 TTTTATAAAGGGATTGAGTTGGG - Intergenic
1000616357 5:163432343-163432365 CTTTAGCAAAAGTTTGAATTGGG - Intergenic
1000951104 5:167484370-167484392 CTTTATAAAAAGGATAATCTTGG + Intronic
1001377816 5:171279463-171279485 CTTTATAAAAAGGTTGAGTTTGG - Intronic
1003733678 6:8854074-8854096 CTTTATAAAATGGTGGGGTGGGG - Intergenic
1005130407 6:22500757-22500779 TTTTATGAAAAGGTTGATTCTGG - Intergenic
1007885840 6:45229124-45229146 TTTTATAAAAATCATGAGTTTGG + Intronic
1008486117 6:52038079-52038101 CTTTATAAAAAGGGGAATTTGGG + Intronic
1009205985 6:60802487-60802509 CTATTTAAAAAGGTTGATTAAGG - Intergenic
1010306161 6:74325439-74325461 CTTTAAAATAAGGTTAATTTGGG - Intergenic
1011246041 6:85322364-85322386 CTTGATCAGAAGTTTGAGTTGGG - Intergenic
1011696741 6:89919976-89919998 CTTGTTAATAATGTTGAGTTGGG - Intergenic
1012271671 6:97220025-97220047 GCTTAGAAAAAGGTTAAGTTGGG - Intronic
1012382138 6:98632742-98632764 TGTTATAAAAAGAATGAGTTGGG + Intergenic
1012837923 6:104293894-104293916 CTTTATAAAAAGGAGAAATTTGG + Intergenic
1013243300 6:108265631-108265653 TTTTTTAAAAAGCTTGAATTAGG + Intergenic
1014118318 6:117691350-117691372 CTTAAGAAAAAGCATGAGTTCGG - Intronic
1016113552 6:140256156-140256178 CTATATAAAAAGGTGAAATTTGG + Intergenic
1016231438 6:141810022-141810044 CCTTATAAAAAGGAGGAATTTGG + Intergenic
1016368181 6:143341520-143341542 CTTTGTAAAAAGGGGGAATTAGG + Intergenic
1016880829 6:148910686-148910708 GTTTATAAAAGGTATGAGTTAGG + Intronic
1017388741 6:153914844-153914866 CTTTATAAGGAGGTTGAGGCAGG - Intergenic
1018997532 6:168721543-168721565 CCTTATAAAAAGGGGAAGTTTGG + Intergenic
1019011767 6:168848728-168848750 CTCTAAAAAAGTGTTGAGTTTGG + Intergenic
1019856842 7:3617694-3617716 CCTAATAAAAAGGGTAAGTTGGG - Intronic
1020468986 7:8514040-8514062 CTTTATAAAAAGGAACAATTGGG - Intronic
1020896550 7:13947318-13947340 CTTAACAAACTGGTTGAGTTTGG + Intronic
1021104356 7:16619452-16619474 CTTTTTAAAAAGGTATAATTAGG - Intronic
1021370913 7:19845459-19845481 AATTATAAAAAGGTTGATTATGG - Intergenic
1021479347 7:21098716-21098738 CTTTAAAAAAAAGTTTAGCTAGG + Intergenic
1021923859 7:25515531-25515553 TTTTATTAAGAGGCTGAGTTGGG - Intergenic
1022331398 7:29382699-29382721 CTTTATAAAAGGCCTGAGTTAGG - Intronic
1023590534 7:41776740-41776762 TTTTAAAAAAGGATTGAGTTGGG + Intergenic
1023756752 7:43425724-43425746 CATGATAAAAAGGATGACTTTGG - Intronic
1024688956 7:51779015-51779037 ATTTTTAAAAAGCTTGAGATTGG + Intergenic
1024791952 7:52975258-52975280 GTTTAAAAAATGTTTGAGTTTGG - Intergenic
1027244275 7:76356106-76356128 CTTTATCAACAGGATGATTTCGG + Intronic
1027771823 7:82416645-82416667 CCTTATAAAAAGGAAGAATTTGG - Intronic
1027961131 7:84947016-84947038 CTTTTTAAAAAGTTTCACTTGGG + Intergenic
1028007671 7:85596740-85596762 CTTTATTAAAAAGGTAAGTTAGG - Intergenic
1028132490 7:87192602-87192624 CTATATAAAAAATTTGATTTAGG - Intronic
1028397885 7:90392470-90392492 CCTTATAAAAAGGGTAAATTTGG - Intronic
1028740153 7:94265269-94265291 ATATATAATAAGGTTGAATTAGG + Intergenic
1030216439 7:107047821-107047843 TTTTTTAAATAGGTTGAGATGGG + Intronic
1030494238 7:110277376-110277398 CTTTGTAAAAGGGGTGAGATAGG + Intergenic
1031632578 7:124062462-124062484 CTTGATAAAAAGGGTAAGTCTGG + Intergenic
1031859442 7:126961169-126961191 CTATGTAAAAAGGTTAAGCTTGG + Intronic
1032107876 7:129050076-129050098 TTTTTTAAAAAGGGTGAGGTGGG + Intronic
1032527990 7:132594222-132594244 CTTTATAAAAAGGGGAAATTTGG + Intronic
1032724880 7:134581455-134581477 CTTCATAAAAAGCTTGGGTTTGG + Intergenic
1033998114 7:147377894-147377916 CTTTATAAAAATGTTTAATTGGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034734849 7:153419169-153419191 CTTTATCAAAAGTTTGACTATGG - Intergenic
1034857404 7:154564722-154564744 CTTTATCACATGGTTGAATTTGG - Intronic
1035525296 8:307708-307730 CTTTTTAAAAAGGTTGATGAGGG + Intergenic
1036134468 8:6147480-6147502 TTTTCTAAATAGGATGAGTTTGG + Intergenic
1038368221 8:26959627-26959649 TTTTATTAAATGGTTGACTTGGG + Intergenic
1039710477 8:40051231-40051253 CTTCATAAAAAGGATGCTTTAGG - Intergenic
1041343373 8:56869765-56869787 TTTAATAAGAATGTTGAGTTTGG - Intergenic
1041530664 8:58862579-58862601 CTTTATTAGAAGTTTGAGTCAGG - Intronic
1041571080 8:59337470-59337492 CATTATAAAAATTTTGATTTTGG + Intergenic
1041594067 8:59625284-59625306 CTTTATAAAAAGATAAAATTGGG - Intergenic
1041795753 8:61746106-61746128 CCTAATAAAAAGTATGAGTTCGG - Intergenic
1043049399 8:75365743-75365765 TTTTCTAAACAGCTTGAGTTAGG + Intergenic
1043244503 8:77980372-77980394 CTTTATAGAATGGTTGAGCATGG + Intergenic
1044645222 8:94434559-94434581 CTTATTAAAAAGGAAGAGTTTGG + Intronic
1044839343 8:96324606-96324628 CCTGATAAAAAGGATGAGTTTGG - Intronic
1045323020 8:101096166-101096188 CTTTATAAATATATTGATTTCGG - Intergenic
1045409161 8:101898386-101898408 TTTTAAAAAAATGTTGAGTTTGG + Intronic
1046333756 8:112755612-112755634 CTTTATAAACAGGGTGAGAACGG + Intronic
1046476137 8:114746240-114746262 CTATTTAAAAGTGTTGAGTTTGG + Intergenic
1046839395 8:118840605-118840627 CCTTATAAAAAGGAGGAATTTGG + Intergenic
1046963536 8:120136660-120136682 TTTGATAAAAAGGTTATGTTAGG + Intronic
1047631999 8:126718126-126718148 CTTTATAGAAAGTTTGAGTTAGG + Intergenic
1047942765 8:129841658-129841680 ATTTAAAAAAAGTTTGTGTTGGG + Exonic
1047967627 8:130058141-130058163 CTTTGTAAAATGGTTGACCTTGG + Intronic
1048859057 8:138710069-138710091 ATTTATAAAATGGTATAGTTAGG - Intronic
1050142632 9:2532501-2532523 TTTTGTAAAAAGGTTGGGTCTGG - Intergenic
1050480334 9:6081288-6081310 CTTTAGAAAGATTTTGAGTTCGG - Intergenic
1051078326 9:13266686-13266708 CTTAATAAAAGGTCTGAGTTAGG - Intronic
1051271810 9:15362992-15363014 CTTGATAAAAATATTGACTTAGG - Intergenic
1051466809 9:17387682-17387704 CTTGAAAAAAAGGTTGTGGTAGG + Intronic
1051561719 9:18449123-18449145 TTATATAAAAAGCATGAGTTGGG + Intergenic
1051854539 9:21548774-21548796 TGTTATTAAAAGGTGGAGTTTGG - Intergenic
1053466795 9:38314503-38314525 CTTCATCAAAAGCTAGAGTTGGG - Intergenic
1055152733 9:73022380-73022402 TTTTATAAAAATGTTGTTTTGGG - Intronic
1055995691 9:82157003-82157025 ATTTATAAAGAGGTTTATTTTGG - Intergenic
1056431051 9:86528258-86528280 TTGTATAAAAAGGTCGAGGTGGG + Intergenic
1057149121 9:92780607-92780629 ATTTATACAGAGCTTGAGTTGGG - Intergenic
1057263856 9:93601340-93601362 CTTTATAAAATAGTTAAGGTTGG + Intronic
1058813963 9:108666954-108666976 CTTTATAAAAAGGGGAAATTTGG + Intergenic
1059072244 9:111150041-111150063 CTTTTTAAAAATGTTAAGTCTGG + Intergenic
1059247385 9:112860324-112860346 CTTTATAAAAGAGCTGTGTTTGG + Intronic
1062079132 9:134610926-134610948 ATTTAGAAAAATGTTCAGTTAGG - Intergenic
1062692195 9:137847861-137847883 CTTTATATAATGGTTTTGTTAGG - Intronic
1186113309 X:6278257-6278279 CCTTATAAAAAGGGGAAGTTTGG - Intergenic
1186946850 X:14578158-14578180 CATTATTAAAAGTTTTAGTTTGG + Intronic
1187287758 X:17922471-17922493 CTTTATAATCAATTTGAGTTGGG + Intergenic
1187350694 X:18514012-18514034 CTTTTTGAAAAGGTTGACTGGGG + Intronic
1188971268 X:36618425-36618447 CTTTTTAAAAAGGAAAAGTTTGG - Intergenic
1189582163 X:42418006-42418028 CTAGAAAAAAAGGATGAGTTGGG - Intergenic
1189651111 X:43190220-43190242 CTTTATAAAAAGGGGAAATTTGG + Intergenic
1189774961 X:44462325-44462347 CTTTACAGAAAGGCAGAGTTTGG - Intergenic
1190135627 X:47794848-47794870 CCTGATAAAAAGGATGAGTTTGG + Intergenic
1190481728 X:50884146-50884168 CTATATAAATAAGCTGAGTTTGG - Intergenic
1195052350 X:101108496-101108518 CTTTAAAAAAATGCTGAATTTGG - Intronic
1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG + Intronic
1196722646 X:118869315-118869337 CTTTACAAAAAGGTTGTAGTCGG - Intergenic
1198710068 X:139491785-139491807 CTTTATAAAAAGGGGAAATTTGG - Intergenic
1200397294 X:155998736-155998758 ATTTATCAAACGGTTGAGTTGGG + Intronic
1201274281 Y:12284071-12284093 CTTTATAAAGGGGGTGAGCTAGG + Intergenic
1201411935 Y:13707247-13707269 CTTTATAAAAACATTCAGCTGGG - Intergenic
1201483642 Y:14468806-14468828 CCTTATAAAAAGGGGGAGTTTGG + Intergenic
1201948683 Y:19540013-19540035 CTTCATTAAAAAGTTGAGTGAGG + Intergenic
1202029474 Y:20556776-20556798 CTTTATAGAAAGGCTGAGACAGG - Intergenic