ID: 1001381365

View in Genome Browser
Species Human (GRCh38)
Location 5:171308666-171308688
Sequence GCTTCGCGCTGCCTGCGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001381365_1001381373 12 Left 1001381365 5:171308666-171308688 CCCGCGCGCAGGCAGCGCGAAGC 0: 1
1: 0
2: 3
3: 6
4: 64
Right 1001381373 5:171308701-171308723 GTGCGCCCCTTTCGTTCCTCCGG 0: 1
1: 0
2: 0
3: 0
4: 37
1001381365_1001381374 15 Left 1001381365 5:171308666-171308688 CCCGCGCGCAGGCAGCGCGAAGC 0: 1
1: 0
2: 3
3: 6
4: 64
Right 1001381374 5:171308704-171308726 CGCCCCTTTCGTTCCTCCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 30
1001381365_1001381377 18 Left 1001381365 5:171308666-171308688 CCCGCGCGCAGGCAGCGCGAAGC 0: 1
1: 0
2: 3
3: 6
4: 64
Right 1001381377 5:171308707-171308729 CCCTTTCGTTCCTCCGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
1001381365_1001381380 30 Left 1001381365 5:171308666-171308688 CCCGCGCGCAGGCAGCGCGAAGC 0: 1
1: 0
2: 3
3: 6
4: 64
Right 1001381380 5:171308719-171308741 TCCGGCGGCGGTAGCGTCCAAGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001381365 Original CRISPR GCTTCGCGCTGCCTGCGCGC GGG (reversed) Exonic
900082603 1:869860-869882 GCTTCGCGCTGCCGCCTGGCTGG + Intergenic
905800248 1:40838353-40838375 TATTCGCGCTGCCTGCGCTCTGG + Exonic
906116286 1:43359288-43359310 GCTTTGCGCTGCCAGCGCGCAGG - Exonic
911664785 1:100539889-100539911 GCTTCTCGCTGCCGGTGCCCTGG + Exonic
913449009 1:118979811-118979833 GCATCGCGCCGCGTGCGCCCGGG - Intronic
918630179 1:186708150-186708172 GCTTTGAGCTGCCTGGGCTCAGG - Intergenic
922674621 1:227542748-227542770 GCTTCGCGCTGCCGCCTGGCTGG - Intergenic
1074399067 10:113126834-113126856 CCTTCCCGCTGCCGGCTCGCGGG - Intronic
1077227772 11:1445856-1445878 GCTCCCCGGTGCCTGCGCGGCGG + Exonic
1077938777 11:6818054-6818076 GCTTTGCTCTGCCTGTGAGCAGG - Intergenic
1078662311 11:13297431-13297453 TCTTCTCGCTGCCTGTGGGCCGG + Intronic
1079296681 11:19241181-19241203 GCTGCGCGGGGCCTGAGCGCGGG + Intronic
1087141290 11:94768318-94768340 GCTCCCCGCTCCCCGCGCGCGGG - Intronic
1091705764 12:2691819-2691841 CCCTCGCGCTGCCTGCGGGCCGG - Intronic
1092246740 12:6868043-6868065 GCTTCCCGCTCCCTGCGCCCTGG + Intronic
1094125049 12:27014495-27014517 GCTGCGCGTTCCCCGCGCGCCGG - Intergenic
1097850260 12:64404451-64404473 GCTTCGCGCTGACTCAGCGGCGG + Exonic
1104355146 12:128078632-128078654 GGTTCGTCCTGCCTGCCCGCTGG + Intergenic
1112498734 13:99926067-99926089 CCTGCGTGCTGCCTGCTCGCCGG - Intergenic
1115651380 14:35404691-35404713 GCTGCGCGCTGCTTCCTCGCTGG + Exonic
1116973611 14:51093857-51093879 GGGGCGCGCTGCCTGCGAGCGGG - Intronic
1118849276 14:69572152-69572174 GCTTGGCGCGGGCCGCGCGCTGG + Exonic
1122880947 14:104690179-104690201 GCTTCCAGCTGCCCACGCGCAGG + Intronic
1125674111 15:41493628-41493650 GCTTCGCTCCGCCTGCCCTCGGG - Intronic
1131174425 15:90201235-90201257 CCCTCGCGCTGCCAGCGCCCGGG + Intronic
1132649308 16:1013448-1013470 GCTGCCCTCTGCCTGCACGCAGG + Intergenic
1137728640 16:50673761-50673783 GCTTTCGGCTGCCTGCGGGCCGG - Exonic
1141170554 16:81688012-81688034 GCTCTGCGCTGCCTGCGCACCGG - Intronic
1141334052 16:83138432-83138454 GCTTCGCGTTGCCTGCTCTTAGG - Intronic
1146399543 17:32492346-32492368 GCTTCCAGCTGCCAGCGCACAGG + Intergenic
1147761217 17:42798695-42798717 CCTTCGCGGTGCCGCCGCGCGGG + Exonic
1152867943 17:82735462-82735484 GCTTCGCGCTTCCTGCGCCCGGG - Intergenic
1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG + Intergenic
1160578520 18:79870481-79870503 GCTGCGCGCTCCCTCTGCGCTGG + Intronic
1160630906 18:80246448-80246470 CCCTCCCGCTGCCTGCGCCCGGG - Intronic
1161042029 19:2115418-2115440 GCTGCCCGCTGCCGGCCCGCAGG - Exonic
1162776606 19:12983632-12983654 GCCCCGCCCTCCCTGCGCGCGGG + Intergenic
1165708933 19:37995837-37995859 GCTTCGCTCTGCCAGCAGGCTGG + Intronic
1168691633 19:58380974-58380996 GCTCCGCGCTGCATGCGGGGCGG - Exonic
926035182 2:9630728-9630750 GGCTCGGGCTCCCTGCGCGCGGG - Intronic
926119082 2:10231757-10231779 GCTGCTCGCTGCCTGCTCTCAGG - Intergenic
932237492 2:70132392-70132414 GCCTGGCGCTGCCTGCTGGCAGG - Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
948262076 2:236612051-236612073 GCTTCAGGCTTCCTGAGCGCTGG - Intergenic
1173955750 20:47031312-47031334 GCTTCCCGGTGCCTGAGCACCGG - Intronic
1174494685 20:50931202-50931224 CCTTAGCGCTGCCTGCGGGAGGG + Exonic
1175788274 20:61725419-61725441 GCTTCGCGCTGCCTGGGAGCAGG + Intronic
1178707350 21:34886876-34886898 GCTCCGTGCTGCCTACGCACTGG - Exonic
1180960607 22:19760750-19760772 GCGCCGCGCTGCGTGCGCCCCGG - Intronic
954275655 3:49540033-49540055 GCTTCGCCCCGCCCGCCCGCCGG - Intergenic
954391734 3:50271156-50271178 GCATCGGGCTGCCTCCGTGCTGG + Exonic
956813611 3:72888305-72888327 GCTCAGCGCGGCCAGCGCGCAGG - Exonic
959359083 3:105367322-105367344 GCCCCGCGGTGCCCGCGCGCTGG - Exonic
961756547 3:129130516-129130538 GCTAAGAGCTGCCTGGGCGCCGG - Intronic
967858268 3:194134320-194134342 GCTGCGTGCTGCCTGCTGGCCGG - Intergenic
968512543 4:1001971-1001993 GCTGCGCGCACCCTGCGGGCGGG - Exonic
968896546 4:3407325-3407347 GCTCTGCCCTGCCTGCACGCAGG - Intronic
969314226 4:6371912-6371934 GCCTCGCCCTGCCTGCAGGCTGG + Intronic
969574129 4:8026523-8026545 CCTTCTCGCTGCCTGCGGCCTGG + Intronic
988540293 5:32102326-32102348 GCTTCGCTCTGGCTGCCCACAGG - Intronic
991686897 5:69189720-69189742 GCTGCACGCCGCCTGGGCGCCGG - Exonic
999272094 5:150302595-150302617 GCCTCCCGCTGCCTAAGCGCAGG + Exonic
999300326 5:150486470-150486492 GCCCCGCGCGGCCTGCACGCCGG - Intronic
1001381365 5:171308666-171308688 GCTTCGCGCTGCCTGCGCGCGGG - Exonic
1001646165 5:173283893-173283915 CCTTCGCGCTGGCGGCGGGCTGG - Intergenic
1019165714 6:170096329-170096351 GCTCCAGGCTGCCTGCGCGGAGG - Intergenic
1030739040 7:113086477-113086499 GCTCGGCGGCGCCTGCGCGCTGG + Intronic
1033443762 7:141402775-141402797 GCCTGGGGCTGCCTGCGCACTGG + Intronic
1033480788 7:141738344-141738366 GCTTTGCGTTCCCTGTGCGCCGG + Intronic
1033651230 7:143345589-143345611 GCTGCGCGCAGCCTGCGCTCAGG - Exonic
1045305048 8:100951384-100951406 CCCTCGCGCAGCCTCCGCGCTGG - Intronic
1047024506 8:120811594-120811616 GCTGCGCGCCGCCCGCGCCCGGG + Exonic
1051483058 9:17579490-17579512 GGTGCGCGCTGCCTTCCCGCGGG + Intronic
1056481541 9:87011727-87011749 GCTTTGCGCTGCCAGCGAGCAGG - Intergenic