ID: 1001381657

View in Genome Browser
Species Human (GRCh38)
Location 5:171309934-171309956
Sequence GAGGGTAATCGGAGAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 60}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001381650_1001381657 -3 Left 1001381650 5:171309914-171309936 CCCCGGGCAGCCGTGGTGGGGAG 0: 1
1: 0
2: 0
3: 28
4: 280
Right 1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 60
1001381646_1001381657 3 Left 1001381646 5:171309908-171309930 CCAGGGCCCCGGGCAGCCGTGGT 0: 1
1: 0
2: 2
3: 43
4: 348
Right 1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 60
1001381642_1001381657 11 Left 1001381642 5:171309900-171309922 CCTCGGCCCCAGGGCCCCGGGCA 0: 1
1: 0
2: 3
3: 63
4: 581
Right 1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 60
1001381651_1001381657 -4 Left 1001381651 5:171309915-171309937 CCCGGGCAGCCGTGGTGGGGAGG 0: 1
1: 0
2: 3
3: 60
4: 502
Right 1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 60
1001381653_1001381657 -5 Left 1001381653 5:171309916-171309938 CCGGGCAGCCGTGGTGGGGAGGG 0: 1
1: 0
2: 11
3: 55
4: 487
Right 1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 60
1001381643_1001381657 5 Left 1001381643 5:171309906-171309928 CCCCAGGGCCCCGGGCAGCCGTG 0: 1
1: 1
2: 1
3: 35
4: 423
Right 1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 60
1001381637_1001381657 27 Left 1001381637 5:171309884-171309906 CCAAGCGCGGCGGAGGCCTCGGC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 60
1001381644_1001381657 4 Left 1001381644 5:171309907-171309929 CCCAGGGCCCCGGGCAGCCGTGG 0: 1
1: 0
2: 0
3: 47
4: 344
Right 1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 60
1001381635_1001381657 28 Left 1001381635 5:171309883-171309905 CCCAAGCGCGGCGGAGGCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001381657 Original CRISPR GAGGGTAATCGGAGAGTTGC AGG Intronic
905575667 1:39042606-39042628 GAGGGTAGACGGAGAGATGTTGG - Intergenic
910026588 1:82662071-82662093 GAGGACAATAGGAGAGTTGTGGG + Intergenic
910731801 1:90405958-90405980 GAGGGTAAATGGATAGTGGCGGG + Intergenic
912624700 1:111197421-111197443 GAGGGTACTGGGTGAGTTGGTGG + Intronic
915762968 1:158333884-158333906 GAGGTTAAACAGACAGTTGCTGG + Intergenic
918206066 1:182310498-182310520 GAGGGGAATGGGGGAGTTGGAGG - Intergenic
923140719 1:231160282-231160304 AAGGCTTATCTGAGAGTTGCAGG + Intergenic
1071845964 10:89521568-89521590 GAGGGTCATGGGAGAGGGGCCGG - Intronic
1073793739 10:106965302-106965324 GAGGGTAAAGGGAGTTTTGCCGG - Intronic
1074036013 10:109739332-109739354 CAGGGTAATGGGAGCTTTGCTGG + Intergenic
1078187810 11:9067052-9067074 GAGGGAGATGGGAGAGTTGGGGG + Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079477760 11:20849109-20849131 GTGGGTCATAGGAGTGTTGCCGG - Intronic
1088177841 11:107074097-107074119 GAGGGTCATGTGAGAGTCGCTGG + Intergenic
1088908833 11:114175418-114175440 GGGGGTAATCTTAGAGTTGTTGG - Intronic
1103364489 12:120371248-120371270 AAGGGTCATTGGAGAGGTGCGGG + Intergenic
1104663272 12:130627772-130627794 GAGGGTCATTGGAGAGGTCCCGG - Intronic
1105913690 13:24893912-24893934 GAGGGTGATGGGAGAGTGGCTGG + Intronic
1113936654 13:113998460-113998482 GAGGGTCATAGAACAGTTGCAGG - Intronic
1124345515 15:28919166-28919188 GGGGATTATCTGAGAGTTGCTGG + Intronic
1127723586 15:61726092-61726114 GAGGATAATCGGGGAGATGTGGG - Intergenic
1129258052 15:74345377-74345399 GAGGGTGCTCGGAGAGGTGAGGG - Intronic
1129299912 15:74619599-74619621 GAGGTTAAGCGGAAAGATGCTGG - Intronic
1133675797 16:8070591-8070613 AAGGGTCATTTGAGAGTTGCAGG - Intergenic
1135354957 16:21761338-21761360 AAGGGTAATGGGAGAGTTGGTGG - Intergenic
1135453441 16:22577480-22577502 AAGGGTAATGGGAGAGTTGGTGG - Intergenic
1138791802 16:59913055-59913077 GAGGGTAAAGGGAGAATTGCAGG + Intergenic
1146403385 17:32517966-32517988 GAGGGTGATGGCAGAGTGGCGGG - Intronic
1146403394 17:32518003-32518025 GAGGGTGATGGCAGAGTGGCGGG - Intronic
1146403403 17:32518040-32518062 GAGGGTGATGGCAGAGTGGCGGG - Intronic
1146403412 17:32518077-32518099 GAGGGTGATGGCAGAGTGGCAGG - Intronic
1146405300 17:32531426-32531448 GAAGGAACTCAGAGAGTTGCAGG - Intronic
1148484333 17:47981047-47981069 GAGGGTAAGCGGCCAGTTGGGGG + Intronic
1155157746 18:23171677-23171699 GAGGGTTATCAGAGGGTGGCAGG - Intronic
1163933819 19:20423887-20423909 TAGGATAAACGGAGATTTGCAGG + Intergenic
927623737 2:24690314-24690336 GAGGGTCATTGGAGAGTTTAAGG + Intronic
935684060 2:105668225-105668247 GGGGGCAATGGGAGAGTTGAGGG - Intergenic
937233274 2:120414686-120414708 GAGGGAAGTCTGAGAGTTGCTGG - Intergenic
942331363 2:174828066-174828088 GAGGGTAAGAGGAGAGAGGCTGG + Intronic
948027556 2:234790168-234790190 GAGGGTGATAGGAGAGGTCCTGG + Intergenic
1169415115 20:5409464-5409486 GAGGGTGATAGGAGAGGTGCAGG + Intergenic
1183091928 22:35528150-35528172 GAGGGTAATGGGGGAGCTGTTGG - Intergenic
949829516 3:8198969-8198991 GAGGGTAAGTGGAGAGAGGCTGG - Intergenic
950433787 3:12966977-12966999 GAGGGAGAGCGGAGAGTTGGTGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951481434 3:23166306-23166328 GAGGGTAATAGGAGGCTTACTGG + Intergenic
957419461 3:79950269-79950291 GAGGGTAATCGGAGACTCACTGG + Intergenic
958036842 3:88180682-88180704 GAGGGTACTTGGAGACTTTCTGG + Intergenic
966059798 3:175741023-175741045 GAGAGTAAAGGGAGAATTGCTGG + Intronic
979674851 4:123398962-123398984 GGGGGTAATCGGCGAATTCCGGG - Intronic
979915370 4:126426232-126426254 AAGGGTAATCGGAGGATTGGGGG - Intergenic
981042595 4:140237127-140237149 GAGGGAAACCGGTGAGTTGTTGG - Intergenic
987488927 5:18552698-18552720 GAGGGTCATTGGAGGGTTGTGGG - Intergenic
995227283 5:109715090-109715112 GAGGGTACTGGGAGAGCTGCAGG + Intronic
997427861 5:133816546-133816568 GGGGGTTATCTGGGAGTTGCAGG - Intergenic
997513598 5:134469271-134469293 TAGGGGAACCGGAGAGTAGCAGG - Intergenic
1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG + Intronic
1005783216 6:29215715-29215737 AAGGGTAACCGGAGGGTGGCAGG - Intergenic
1006322575 6:33328948-33328970 GAGGGAAATGGGAGTGTTGGGGG - Intronic
1019820062 7:3235763-3235785 GATGGTAATGGGAGAGATGGTGG + Intergenic
1021971329 7:25968299-25968321 GAGGGTAAAGGGAGGGTAGCCGG + Intergenic
1022020470 7:26395689-26395711 GAGGGTAAGGGGAGCGGTGCAGG - Intergenic
1027742975 7:82036219-82036241 GAAGGTATTCGTAGAGATGCTGG - Intronic
1037576266 8:20206694-20206716 GAGGGTGTTTGGAGAGTTTCTGG - Intronic
1037618330 8:20541421-20541443 GAGAGTGAGAGGAGAGTTGCTGG + Intergenic
1042612137 8:70610731-70610753 GAGGGGAAATGGAGAGTTACTGG - Intronic
1049268720 8:141683022-141683044 GAGGGTAATCGGCGAGAAGAGGG - Intergenic
1060312435 9:122474535-122474557 GAGGGAAATGTGAAAGTTGCAGG + Intergenic
1186595642 X:10978975-10978997 GATGGGAATTAGAGAGTTGCAGG + Intergenic