ID: 1001381903

View in Genome Browser
Species Human (GRCh38)
Location 5:171311028-171311050
Sequence CCGGGGTCGCTGGGGTCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001381903_1001381918 27 Left 1001381903 5:171311028-171311050 CCCGCGGACCCCAGCGACCCCGG 0: 1
1: 0
2: 1
3: 25
4: 196
Right 1001381918 5:171311078-171311100 TAGGCCCTGCCCTTGCTATCTGG No data
1001381903_1001381916 8 Left 1001381903 5:171311028-171311050 CCCGCGGACCCCAGCGACCCCGG 0: 1
1: 0
2: 1
3: 25
4: 196
Right 1001381916 5:171311059-171311081 GGGCCAAGTCAGTTACACATAGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001381903 Original CRISPR CCGGGGTCGCTGGGGTCCGC GGG (reversed) Intronic