ID: 1001381903

View in Genome Browser
Species Human (GRCh38)
Location 5:171311028-171311050
Sequence CCGGGGTCGCTGGGGTCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001381903_1001381918 27 Left 1001381903 5:171311028-171311050 CCCGCGGACCCCAGCGACCCCGG 0: 1
1: 0
2: 1
3: 25
4: 196
Right 1001381918 5:171311078-171311100 TAGGCCCTGCCCTTGCTATCTGG No data
1001381903_1001381916 8 Left 1001381903 5:171311028-171311050 CCCGCGGACCCCAGCGACCCCGG 0: 1
1: 0
2: 1
3: 25
4: 196
Right 1001381916 5:171311059-171311081 GGGCCAAGTCAGTTACACATAGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001381903 Original CRISPR CCGGGGTCGCTGGGGTCCGC GGG (reversed) Intronic
900096003 1:940362-940384 GCGGGGGCGCTGGGCCCCGCTGG + Intronic
900146375 1:1160659-1160681 CAGGTGTCGCTGGGGCCCACGGG - Intergenic
900423637 1:2566519-2566541 ACCGGGTCGGTGGGGACCGCTGG - Intergenic
900586499 1:3434876-3434898 CCGGAGCCGCTGGGGTCAGGTGG - Exonic
900658786 1:3772759-3772781 CCCGCGTCTCTGGGCTCCGCAGG - Intergenic
902323472 1:15683995-15684017 CCGGAGTCCCTGGGGTCTGAGGG + Intergenic
902368826 1:15993203-15993225 CCTGGGTCTCTGGAGTCCTCAGG - Intergenic
903210322 1:21814619-21814641 CCGGGGGCGCACGGGTCGGCCGG - Exonic
903280021 1:22245032-22245054 CCAGGGTAGCTGGGGTTGGCAGG + Intergenic
903448478 1:23437225-23437247 CCGGGGTCCTGGGGGTCCGCCGG - Exonic
903604910 1:24568405-24568427 CCGAGGTCCCTGGGGACCCCAGG - Intronic
906109210 1:43312179-43312201 CAGGGGTCCCTGGGGTCGACGGG - Intronic
908780649 1:67686336-67686358 TCGGGGTCGCTGGGGGCAGCGGG - Exonic
911188416 1:94926325-94926347 TCGGGGCCCCTGGGGTCGGCGGG + Intronic
912416190 1:109509610-109509632 CCGCGGTCGGTGGGCTCCGGCGG - Exonic
913075528 1:115338128-115338150 CAGGGGTGGCTGGGCTTCGCGGG - Intronic
914201752 1:145491343-145491365 CCGGGGTCCCTGGGTTCTGAAGG + Intergenic
914480876 1:148064467-148064489 CCGGGGTCCCTGGGTTCTGAAGG + Intergenic
918282766 1:183023008-183023030 CGGGAGTCGCTGGGGTCCTTGGG - Intergenic
920054355 1:203181708-203181730 CCGAGGTCACTGGGGACTGCTGG - Intronic
920704736 1:208243161-208243183 CCGGGGTCCCTGGTGGCCGCCGG - Intronic
924613176 1:245590295-245590317 CCGGGGCGGCTGGGCCCCGCGGG + Intronic
1063133478 10:3197413-3197435 CCGGGGTGTCTGGGGTGTGCAGG - Intergenic
1070257538 10:74825294-74825316 GCGGAGACGCTGGTGTCCGCGGG - Intergenic
1070733978 10:78851165-78851187 CAGGGCTGGCTGGGGGCCGCAGG - Intergenic
1072151675 10:92689678-92689700 CCGGGGTGCCTGGAGTCCCCAGG + Intergenic
1072624097 10:97099763-97099785 CCGGGGTCTCTGGCCTCCCCTGG - Intronic
1073461027 10:103665965-103665987 CTGGGGTCCCAGGGGTCCCCTGG + Intronic
1074996358 10:118760410-118760432 CCGGGGCCGGCGGGGCCCGCTGG + Intergenic
1076031642 10:127164082-127164104 CAGGGGACGCAGGGGTCAGCCGG + Intronic
1076840348 10:133042205-133042227 CCGGGAAGGCTGGGGTCCGTGGG + Intergenic
1076916399 10:133424758-133424780 CGGGGGTCGCGGGGGACCGCGGG - Intergenic
1076936506 10:133569553-133569575 CGGGGGTCGCGGGGGACCGCGGG - Intronic
1077063391 11:627235-627257 CCGGGATCGCTGGGCGCGGCCGG - Intergenic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1077404732 11:2377860-2377882 CCGGGGCTTCTGGGGGCCGCCGG + Intronic
1077491367 11:2862410-2862432 CCTGGGCCGCTAGGGGCCGCGGG + Intergenic
1077602034 11:3580897-3580919 ACGCGGGCGCTGGGGTCCGGGGG - Intergenic
1084024756 11:66440996-66441018 CCGGGGCCGGTGGGGCCGGCCGG + Intronic
1084371856 11:68750473-68750495 ACGGGTTCCTTGGGGTCCGCCGG + Exonic
1084745006 11:71164447-71164469 CTGGGGACACTGGGGCCCGCTGG - Intronic
1091823119 12:3491087-3491109 CCGGGGGCGCTGGGGGCCCTCGG + Intronic
1094843230 12:34350609-34350631 CCGGAGCCGCTGGGCCCCGCAGG - Intergenic
1095533964 12:43224420-43224442 CCGGGGCCGGTGGGGCCGGCTGG - Intergenic
1100600633 12:96109002-96109024 CCGGGGCCGGTGGGGCCGGCCGG - Intergenic
1102453375 12:113057150-113057172 CCGGGTGCGCTGGGGTGCGCCGG - Intronic
1102519629 12:113470488-113470510 GCGGAGTCGCTGGGGCCGGCAGG + Intronic
1102572483 12:113835538-113835560 CCGGGGTCAGTGGGGGCTGCCGG + Intronic
1103749836 12:123151066-123151088 CAGCGGCCGCTGGGGTGCGCGGG - Intergenic
1104376166 12:128267068-128267090 CCGCGGTCGCGGGGCTCGGCGGG + Intergenic
1104817989 12:131659706-131659728 CCAGGGCAGCTGGGGTCTGCAGG - Intergenic
1104936654 12:132368046-132368068 CTGGGGTCGCTGGGGGTCTCTGG - Intergenic
1104936661 12:132368065-132368087 TCGGGGTCACTGGGGGTCGCTGG - Intergenic
1108676098 13:52739219-52739241 CCGGGTGCGCTGGGGGCCGCAGG - Intronic
1109563171 13:64077757-64077779 CCGGGGCCGGTGGGGCCGGCCGG + Intergenic
1110874382 13:80490825-80490847 CCGGGGTCGGCAGGGCCCGCCGG + Intergenic
1113294177 13:108939320-108939342 CCAGGGTTGCTGGGGTCCCCGGG + Intronic
1114065413 14:19055150-19055172 TCGGGGCCGCTGGTGTCGGCGGG + Intergenic
1114075383 14:19158772-19158794 CCAGGGTCGCCAGGGTCCACGGG - Intergenic
1114086888 14:19241208-19241230 CCAGGGTCGCCAGGGTCCACGGG + Intergenic
1114096849 14:19344852-19344874 TCGGGGCCGCTGGTGTCGGCGGG - Intergenic
1119651512 14:76387217-76387239 GAGGGGAAGCTGGGGTCCGCTGG - Intronic
1122470866 14:101965015-101965037 CCGGGGTCGCAGATGTCCCCGGG + Intronic
1122638065 14:103139360-103139382 TCGGGGGCGCTGGGGTCCCCAGG + Intergenic
1122749415 14:103921615-103921637 CCGGGGGCGCTGTGGTGCGGAGG - Intronic
1122857382 14:104566332-104566354 CCGGGGCTGCCGGGGACCGCAGG + Intronic
1202899463 14_GL000194v1_random:27093-27115 CCAGGGTCGCCTGGGTCCACGGG + Intergenic
1202904386 14_GL000194v1_random:59969-59991 CCGGAGGGGCTGGGGTCCCCAGG - Intergenic
1129159653 15:73740249-73740271 CCCGTGTCCCTGGGGTCCGCTGG + Exonic
1129258890 15:74351622-74351644 TTGGAGTGGCTGGGGTCCGCAGG - Intronic
1129289203 15:74550580-74550602 CCGGAGTAGCTTGGGACCGCAGG - Intronic
1130253260 15:82314311-82314333 CCGGGGGTGGTGGGGTCAGCTGG - Intergenic
1130283905 15:82540206-82540228 CCGGTGTGGTTGGGGACCGCCGG + Intronic
1131829439 15:96344771-96344793 CCAGGGTCGCTGGGGGCCAGAGG + Intergenic
1132320032 15:100919146-100919168 CGGGAGACGCCGGGGTCCGCGGG - Intergenic
1132547660 16:540663-540685 CTGGGGTCGCTGGCGGCTGCAGG + Intronic
1132610383 16:813203-813225 CCGGGGTCTGTGAGGCCCGCAGG + Intronic
1134441117 16:14300404-14300426 CCGGGGTCGGTGGGGCACGGGGG - Intergenic
1136245834 16:28975224-28975246 CCGGGGTTGCCAGGGTCCACGGG + Exonic
1138023070 16:53502599-53502621 CCAGGCTCGCTGGGGACAGCCGG + Intronic
1139954298 16:70685943-70685965 CCGGGGTCGCGGGCCTCCGGCGG + Exonic
1142132187 16:88436195-88436217 CTGGAGTCGCTGAGGTCCGTGGG - Exonic
1142343178 16:89537270-89537292 CCGGGGGCTCTGGGGTCCGCAGG - Intronic
1142354760 16:89597148-89597170 CCTGGGTCCATGGGGTCTGCGGG + Exonic
1143532381 17:7512872-7512894 CCGGGCTCCCCGGGGTCCCCAGG + Exonic
1144500846 17:15786233-15786255 CCGGGGCGGCGGGGGTCCGGCGG - Intergenic
1144638275 17:16924457-16924479 CCTGGGTCTCTGGAGTCCTCGGG + Intergenic
1145163007 17:20588895-20588917 CCGGGGCGGCGGGGGTCCGGCGG - Intergenic
1145761783 17:27429641-27429663 CCTGGGTCTCTGGAGTCCTCAGG - Intergenic
1146716200 17:35089068-35089090 GCGGCGGCGCTGGGGGCCGCTGG - Intronic
1146860634 17:36294844-36294866 CCGGGGTAGCTGGGGACTACAGG - Intronic
1147090963 17:38098939-38098961 CCGGGGTAGCTGGGGACTACAGG - Intergenic
1147106249 17:38221565-38221587 CCGGGGTAGCTGGGGACTACAGG + Intergenic
1147186814 17:38717517-38717539 CCGAGGTCCCTGGGGGCCCCAGG - Exonic
1147200801 17:38799831-38799853 CAGGCGTCGCTGTGGACCGCGGG + Exonic
1148929921 17:51120192-51120214 CCGGGGTACCTGGAGGCCGCCGG + Intronic
1149430619 17:56593733-56593755 CCGCCGCCGCTGGAGTCCGCCGG + Exonic
1149995943 17:61405922-61405944 CCAGGGTCGCTGGGATCCTCTGG + Intronic
1150778618 17:68101519-68101541 GCGGGGCCGGTGGGGTCAGCGGG - Intergenic
1152174987 17:78781812-78781834 TTGGGGTCGCTGGGGTCCCCGGG - Intronic
1152227158 17:79097810-79097832 CCGGTGTCGCTGGGGTTCCCAGG - Intronic
1152380812 17:79941539-79941561 CCGAGGTCGGTGGTGTCCTCTGG - Intronic
1152745359 17:82036314-82036336 CCGGGACAGCTGGGGTCAGCAGG + Intronic
1155877222 18:31102010-31102032 CCGGGGTAGGAGGGCTCCGCGGG + Exonic
1159754066 18:72341220-72341242 CCCGAGTAGCTGGGATCCGCCGG - Intergenic
1160453191 18:78979304-78979326 CCGGAGTCGGTGGGGCCCGCGGG + Intergenic
1160454825 18:78992904-78992926 GCGGGCGCGCTGGGCTCCGCAGG - Exonic
1160847810 19:1174069-1174091 CCCCGGGCGCAGGGGTCCGCGGG + Intronic
1161101596 19:2424503-2424525 CCGGGTTAGGTGGGGACCGCGGG - Intronic
1163026881 19:14517869-14517891 CCGGGGCTGCTCGGGGCCGCGGG + Intronic
1163126861 19:15248995-15249017 CCTGGTTCTCTGGGGTCCTCTGG - Intronic
1163478751 19:17542207-17542229 CCGGGGGCGCTTGGGGCAGCTGG + Exonic
1164457585 19:28421451-28421473 CCGAGGTAGCTGGGGGCTGCTGG - Intergenic
1165114622 19:33521636-33521658 CCGGGGTCGCTGAATGCCGCGGG - Intronic
1165239004 19:34448468-34448490 CCTGAGTAGCTGGGGACCGCAGG - Intronic
1165951044 19:39474095-39474117 CCGGCGTCCCTGGCGTCTGCGGG - Exonic
1166209707 19:41298435-41298457 CTGTGGTCGCTGGGGGCTGCTGG - Intronic
1166790416 19:45395780-45395802 CGGCGCTCGCTGGGCTCCGCGGG - Exonic
1167074272 19:47239555-47239577 GCGGGGGCGCGGGCGTCCGCAGG + Intergenic
1167272204 19:48511820-48511842 CCGGGGTTGCTGGGGTGGGGGGG + Intronic
1167331206 19:48857439-48857461 CCCGGGTCCCAGGGGGCCGCGGG + Exonic
1202647989 1_KI270706v1_random:158542-158564 CCAGGGTCGCCTGGGTCCACGGG - Intergenic
927357068 2:22186440-22186462 CCGGGGCCGGCGGGGCCCGCGGG - Intergenic
927472356 2:23385716-23385738 CCGGGGTCGCGGGTGGGCGCAGG - Exonic
929983128 2:46699268-46699290 CCGGCGGAGCTGGGGTCCCCGGG + Intronic
933791732 2:85888780-85888802 TCGGCGTCGCGGGGGCCCGCGGG - Intronic
938489506 2:131754427-131754449 CCGGGGTCGCCAGGGTCCACGGG - Intronic
944955131 2:204799248-204799270 CCTGGGTCGCTGGTGGCTGCAGG + Intronic
948843705 2:240672867-240672889 CTGGGCGCGCTGGGGGCCGCTGG + Intergenic
949041748 2:241852788-241852810 CCGGGCTGGCTGCGGTCCTCGGG + Exonic
1170889907 20:20368191-20368213 CCGGGGGCACTGAGGGCCGCCGG + Exonic
1171977739 20:31606112-31606134 CCTGGATGGCTGGGGTCCGCCGG - Exonic
1174482568 20:50841859-50841881 CGGAGGTGGCTGGGATCCGCAGG + Exonic
1175168990 20:57066748-57066770 CCGGGGTTCCTGGGGTCCCAGGG + Intergenic
1175837282 20:62004197-62004219 CCTGGGTTGCTGAGGTCAGCAGG - Intronic
1175933227 20:62503196-62503218 CCGGGGTGGATGGGGTGCCCTGG + Intergenic
1176603857 21:8814187-8814209 CCAGGGTCGCCTGGGTCCACGGG + Intergenic
1176618839 21:9041865-9041887 CCAGGGTCGCCTGGGTCCACGGG + Intergenic
1176623754 21:9074736-9074758 CCGGAGGGGCTGGGGTCCCCAGG - Intergenic
1178082224 21:29077379-29077401 CCGGGGCCGGTGGGGCCGGCAGG + Intergenic
1179581983 21:42349906-42349928 CCAGTGTCACTGGGGTCCCCTGG - Exonic
1180014247 21:45072573-45072595 CCGTGGTGGCTGGGCTCCGTCGG - Intergenic
1180064390 21:45405300-45405322 CGGGGGTCGCGGGGCTCGGCCGG + Intronic
1180064402 21:45405329-45405351 CGGGGGTCGCGGGGGTCCTGCGG + Intronic
1180092162 21:45538725-45538747 CCGGGGATGCTGGGGTCCCTGGG - Intronic
1180346142 22:11705764-11705786 CCAGGGTCGCCTGGGTCCACGGG + Intergenic
1180384332 22:12168404-12168426 CCAGGGTCGCCTGGGTCCACGGG - Intergenic
1180483903 22:15777770-15777792 TCGGGGCCGCTGGTGTCGGCGGG + Intergenic
1181030363 22:20146562-20146584 CAGGGGTCGGTGGGTTCCTCAGG + Intronic
1181813772 22:25421376-25421398 AGGGGGTCGCTGGCGGCCGCAGG - Intergenic
1184617616 22:45648672-45648694 CCGGGGTGGCTGGTGTCCACAGG - Intergenic
1185397632 22:50600924-50600946 TCGGGGTCGGGGGGGTGCGCAGG - Intronic
950097025 3:10336484-10336506 CCGGGGACCCTGGGGCCTGCAGG - Intronic
950125246 3:10506431-10506453 CCGGGGTCCCTGGGTTCCCGTGG - Intronic
950517850 3:13479457-13479479 CTGGGATCCCTGGGCTCCGCGGG - Intergenic
950632632 3:14293309-14293331 CCGGGGCCCGCGGGGTCCGCCGG - Intergenic
952713305 3:36453443-36453465 CCGGGGCCGGTGGGGCCGGCCGG - Intronic
953641328 3:44711058-44711080 CCGGTGGAGCTGGGGTCCCCAGG - Intergenic
956229637 3:66998739-66998761 CCGGGCTCGCCGGGCTCCGCAGG + Intronic
957002275 3:74900196-74900218 CCTGGGCCGGTGGGGCCCGCCGG + Intergenic
962804341 3:138916079-138916101 CGGGGGTCCCAGGGATCCGCAGG + Intergenic
968479357 4:826564-826586 CGGGGGTCGCAGGCGCCCGCCGG - Intergenic
968512668 4:1002491-1002513 CCGGGGCCGCTGGGGTGGGCCGG + Intronic
968541675 4:1171306-1171328 CCGGTGCCGCTGGGGACGGCGGG + Exonic
968573719 4:1355337-1355359 GGGGTGTGGCTGGGGTCCGCCGG - Intronic
968746435 4:2362893-2362915 CAGGGGTGGGTGGGGTCCGCAGG - Intronic
973386762 4:49518526-49518548 CCAGGGTCGCCTGGGTCCACGGG + Intergenic
974827743 4:67151978-67152000 CCGGGGCCGGTAGGGCCCGCCGG - Intergenic
984901736 4:184592007-184592029 CCGGGGCCGGTGGGGCCGGCCGG - Intergenic
985602543 5:842828-842850 CCGGGGTCGCCGGGAGCCACAGG - Intronic
985727598 5:1524111-1524133 CCGGGGCCGCTGGGGACCGGGGG + Intergenic
987373986 5:17217737-17217759 CCGGGGTCGCTGGCGTCGTCTGG - Exonic
988489145 5:31692231-31692253 CCGGGGCCGGTGGGGCCGGCCGG + Intronic
990428553 5:55712333-55712355 CCTGGGTCGCAGGGGCCGGCGGG + Exonic
990557700 5:56952026-56952048 CGGGGGTCGCGGGGAGCCGCCGG + Intronic
1001381903 5:171311028-171311050 CCGGGGTCGCTGGGGTCCGCGGG - Intronic
1005725071 6:28640003-28640025 CCGGGGCCGGTGGGGTCGGCCGG + Intergenic
1005763467 6:28988645-28988667 CAGGGGACGCTGTGGTTCGCAGG - Intergenic
1006594464 6:35182584-35182606 CGGGGTCCCCTGGGGTCCGCGGG - Intergenic
1007781595 6:44257600-44257622 GCGGGGGCGCTGTGGTCCGGCGG - Intronic
1015786174 6:136922892-136922914 GCGGGGTGGGTGGGGTCGGCTGG - Intronic
1019395759 7:816840-816862 CCGGGGTAGCTGCGGGGCGCGGG - Intronic
1020032034 7:4940204-4940226 CCGGGGGAGCTGGGGTGTGCCGG - Intronic
1021761291 7:23904972-23904994 CCGGGGCCGGTGGGGCCGGCGGG + Intergenic
1022094561 7:27130586-27130608 TCGGGGGCGCTGGGGGCTGCTGG + Exonic
1024993506 7:55254466-55254488 CTGGGGCCGCAGGGGTGCGCAGG - Intronic
1026828241 7:73596864-73596886 CCGGGGACCCTGGGGACCGGAGG + Exonic
1027244793 7:76359431-76359453 CCGAGGCCGCTGGGGACCCCTGG + Intergenic
1029701482 7:102249140-102249162 CCGGGGTCGGTGCAGGCCGCGGG - Exonic
1029903953 7:104071898-104071920 CCGGGGCCGGTGGGGCCGGCTGG - Intergenic
1029981920 7:104886914-104886936 CCGGGGTCCCCGGGGTCCCCAGG + Intronic
1031923696 7:127619476-127619498 CCGGGGCAGCTGGGGACTGCTGG + Intergenic
1032095876 7:128938330-128938352 CCTGGGTCACTGGGCTCCCCGGG - Intronic
1035735272 8:1882900-1882922 ACGGGGAGGCTGGGGTCAGCAGG - Intronic
1036258228 8:7221683-7221705 ACGCGGGCGCTGGGGTCCGGGGG - Intergenic
1036310276 8:7680279-7680301 ACGCGGGCGCTGGGGTCCGGGGG - Intergenic
1037065005 8:14566938-14566960 CCGGGGCCGGTGGGGCCAGCTGG - Intronic
1037768291 8:21784951-21784973 ACGGGCTGGCTGGGGGCCGCAGG - Intronic
1040552658 8:48450541-48450563 TCGGGGTCCCTGGGGCCAGCAGG - Intergenic
1048533357 8:135270758-135270780 TCGGGGTCCCTGGGCTCTGCAGG + Intergenic
1049554929 8:143277044-143277066 ACGGGGTCCCTGGGGTCTGGCGG + Intergenic
1054350885 9:64016178-64016200 CCAGGGTCGCCAGGGTCCACCGG + Intergenic
1057596029 9:96417344-96417366 CCGGGGTCGCTGGGGAGGCCGGG - Intronic
1059891458 9:118809477-118809499 CCCGGGTCGGCGGGGCCCGCCGG + Intergenic
1060594245 9:124838973-124838995 CCGGGGCCGGTGGGGCCGGCCGG + Intergenic
1060827466 9:126695224-126695246 CCGAGGCCGCTGGGAGCCGCTGG - Intronic
1061851341 9:133417868-133417890 CCGGGGTCTCGGGTGGCCGCCGG - Exonic
1062363552 9:136198583-136198605 GCGGGGTCGCAGGGGTCCCAGGG - Intronic
1203769090 EBV:40128-40150 CCTGGGTGGGTGCGGTCCGCTGG + Intergenic
1203697932 Un_GL000214v1:114639-114661 CCAGGGTCGCCTGGGTCCACAGG - Intergenic
1203746940 Un_GL000218v1:45164-45186 CCGGAGGGGCTGGGGTCCCCAGG - Intergenic
1203563167 Un_KI270744v1:74316-74338 CCGGAGGGGCTGGGGTCCCCAGG + Intergenic
1185457619 X:318712-318734 CCGCGGCCGCTCGGCTCCGCGGG - Exonic
1186618720 X:11215308-11215330 ACGGGGTCGCTGGGGGACCCAGG + Intronic
1187172888 X:16869645-16869667 CGGGGGTTGCTGGGGTCCTCAGG - Exonic
1187172991 X:16869988-16870010 CCGGGGCCGCGGGGGGCGGCGGG - Intronic
1188082455 X:25860629-25860651 CCTGGGTCTCTGGGGTCCAATGG - Intergenic
1190618430 X:52262190-52262212 CCGGGGGCGCTGAGGTCGCCGGG - Intergenic
1196083164 X:111655099-111655121 CGGGGGTAGCTGGGGGCCTCTGG + Intergenic
1196833098 X:119791545-119791567 CCGGGGCCGATGGGGGCCGATGG + Intronic
1198005547 X:132489568-132489590 CCGGGCTGCCTGGGGTCGGCGGG - Intronic
1201152546 Y:11101954-11101976 CCAGGGTCGCCTGGGTCCACGGG + Intergenic
1201160265 Y:11160178-11160200 CCGGAGGGGCTGGGGTCCCCAGG - Intergenic