ID: 1001382261

View in Genome Browser
Species Human (GRCh38)
Location 5:171312395-171312417
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001382249_1001382261 27 Left 1001382249 5:171312345-171312367 CCTGGGTGCGCACGGGATGGGGA No data
Right 1001382261 5:171312395-171312417 CGAAGGCCGCGGGCCAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001382261 Original CRISPR CGAAGGCCGCGGGCCAGCGC CGG Intergenic