ID: 1001382885

View in Genome Browser
Species Human (GRCh38)
Location 5:171315550-171315572
Sequence GCCTCACTCCCTGCCCGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001382885_1001382891 12 Left 1001382885 5:171315550-171315572 CCGGTCCGGGCAGGGAGTGAGGC No data
Right 1001382891 5:171315585-171315607 TCCCTAGGAGGCCGCGCAGCGGG No data
1001382885_1001382899 28 Left 1001382885 5:171315550-171315572 CCGGTCCGGGCAGGGAGTGAGGC No data
Right 1001382899 5:171315601-171315623 CAGCGGGTAGGGTATGGGACTGG No data
1001382885_1001382890 11 Left 1001382885 5:171315550-171315572 CCGGTCCGGGCAGGGAGTGAGGC No data
Right 1001382890 5:171315584-171315606 CTCCCTAGGAGGCCGCGCAGCGG No data
1001382885_1001382896 22 Left 1001382885 5:171315550-171315572 CCGGTCCGGGCAGGGAGTGAGGC No data
Right 1001382896 5:171315595-171315617 GCCGCGCAGCGGGTAGGGTATGG No data
1001382885_1001382889 0 Left 1001382885 5:171315550-171315572 CCGGTCCGGGCAGGGAGTGAGGC No data
Right 1001382889 5:171315573-171315595 CACAGTCAGTTCTCCCTAGGAGG No data
1001382885_1001382894 16 Left 1001382885 5:171315550-171315572 CCGGTCCGGGCAGGGAGTGAGGC No data
Right 1001382894 5:171315589-171315611 TAGGAGGCCGCGCAGCGGGTAGG No data
1001382885_1001382887 -3 Left 1001382885 5:171315550-171315572 CCGGTCCGGGCAGGGAGTGAGGC No data
Right 1001382887 5:171315570-171315592 GGCCACAGTCAGTTCTCCCTAGG No data
1001382885_1001382900 29 Left 1001382885 5:171315550-171315572 CCGGTCCGGGCAGGGAGTGAGGC No data
Right 1001382900 5:171315602-171315624 AGCGGGTAGGGTATGGGACTGGG No data
1001382885_1001382901 30 Left 1001382885 5:171315550-171315572 CCGGTCCGGGCAGGGAGTGAGGC No data
Right 1001382901 5:171315603-171315625 GCGGGTAGGGTATGGGACTGGGG No data
1001382885_1001382895 17 Left 1001382885 5:171315550-171315572 CCGGTCCGGGCAGGGAGTGAGGC No data
Right 1001382895 5:171315590-171315612 AGGAGGCCGCGCAGCGGGTAGGG No data
1001382885_1001382898 23 Left 1001382885 5:171315550-171315572 CCGGTCCGGGCAGGGAGTGAGGC No data
Right 1001382898 5:171315596-171315618 CCGCGCAGCGGGTAGGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001382885 Original CRISPR GCCTCACTCCCTGCCCGGAC CGG (reversed) Intergenic
No off target data available for this crispr