ID: 1001383240

View in Genome Browser
Species Human (GRCh38)
Location 5:171317658-171317680
Sequence GAACTGTTTTAGGGGATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001383240_1001383248 20 Left 1001383240 5:171317658-171317680 CCATTGATCCCCTAAAACAGTTC No data
Right 1001383248 5:171317701-171317723 AGTTGAGAAGCAGAGAAGGCAGG No data
1001383240_1001383244 -4 Left 1001383240 5:171317658-171317680 CCATTGATCCCCTAAAACAGTTC No data
Right 1001383244 5:171317677-171317699 GTTCTGTGTTCCCATTAAGTAGG No data
1001383240_1001383247 16 Left 1001383240 5:171317658-171317680 CCATTGATCCCCTAAAACAGTTC No data
Right 1001383247 5:171317697-171317719 AGGAAGTTGAGAAGCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001383240 Original CRISPR GAACTGTTTTAGGGGATCAA TGG (reversed) Intergenic
No off target data available for this crispr