ID: 1001383244

View in Genome Browser
Species Human (GRCh38)
Location 5:171317677-171317699
Sequence GTTCTGTGTTCCCATTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001383239_1001383244 -3 Left 1001383239 5:171317657-171317679 CCCATTGATCCCCTAAAACAGTT No data
Right 1001383244 5:171317677-171317699 GTTCTGTGTTCCCATTAAGTAGG No data
1001383237_1001383244 4 Left 1001383237 5:171317650-171317672 CCACCATCCCATTGATCCCCTAA No data
Right 1001383244 5:171317677-171317699 GTTCTGTGTTCCCATTAAGTAGG No data
1001383235_1001383244 14 Left 1001383235 5:171317640-171317662 CCTACACCTTCCACCATCCCATT No data
Right 1001383244 5:171317677-171317699 GTTCTGTGTTCCCATTAAGTAGG No data
1001383238_1001383244 1 Left 1001383238 5:171317653-171317675 CCATCCCATTGATCCCCTAAAAC No data
Right 1001383244 5:171317677-171317699 GTTCTGTGTTCCCATTAAGTAGG No data
1001383236_1001383244 8 Left 1001383236 5:171317646-171317668 CCTTCCACCATCCCATTGATCCC No data
Right 1001383244 5:171317677-171317699 GTTCTGTGTTCCCATTAAGTAGG No data
1001383240_1001383244 -4 Left 1001383240 5:171317658-171317680 CCATTGATCCCCTAAAACAGTTC No data
Right 1001383244 5:171317677-171317699 GTTCTGTGTTCCCATTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001383244 Original CRISPR GTTCTGTGTTCCCATTAAGT AGG Intergenic
No off target data available for this crispr