ID: 1001383247

View in Genome Browser
Species Human (GRCh38)
Location 5:171317697-171317719
Sequence AGGAAGTTGAGAAGCAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001383241_1001383247 8 Left 1001383241 5:171317666-171317688 CCCCTAAAACAGTTCTGTGTTCC No data
Right 1001383247 5:171317697-171317719 AGGAAGTTGAGAAGCAGAGAAGG No data
1001383237_1001383247 24 Left 1001383237 5:171317650-171317672 CCACCATCCCATTGATCCCCTAA No data
Right 1001383247 5:171317697-171317719 AGGAAGTTGAGAAGCAGAGAAGG No data
1001383239_1001383247 17 Left 1001383239 5:171317657-171317679 CCCATTGATCCCCTAAAACAGTT No data
Right 1001383247 5:171317697-171317719 AGGAAGTTGAGAAGCAGAGAAGG No data
1001383238_1001383247 21 Left 1001383238 5:171317653-171317675 CCATCCCATTGATCCCCTAAAAC No data
Right 1001383247 5:171317697-171317719 AGGAAGTTGAGAAGCAGAGAAGG No data
1001383243_1001383247 6 Left 1001383243 5:171317668-171317690 CCTAAAACAGTTCTGTGTTCCCA No data
Right 1001383247 5:171317697-171317719 AGGAAGTTGAGAAGCAGAGAAGG No data
1001383240_1001383247 16 Left 1001383240 5:171317658-171317680 CCATTGATCCCCTAAAACAGTTC No data
Right 1001383247 5:171317697-171317719 AGGAAGTTGAGAAGCAGAGAAGG No data
1001383236_1001383247 28 Left 1001383236 5:171317646-171317668 CCTTCCACCATCCCATTGATCCC No data
Right 1001383247 5:171317697-171317719 AGGAAGTTGAGAAGCAGAGAAGG No data
1001383242_1001383247 7 Left 1001383242 5:171317667-171317689 CCCTAAAACAGTTCTGTGTTCCC No data
Right 1001383247 5:171317697-171317719 AGGAAGTTGAGAAGCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001383247 Original CRISPR AGGAAGTTGAGAAGCAGAGA AGG Intergenic
No off target data available for this crispr