ID: 1001383248

View in Genome Browser
Species Human (GRCh38)
Location 5:171317701-171317723
Sequence AGTTGAGAAGCAGAGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001383239_1001383248 21 Left 1001383239 5:171317657-171317679 CCCATTGATCCCCTAAAACAGTT No data
Right 1001383248 5:171317701-171317723 AGTTGAGAAGCAGAGAAGGCAGG No data
1001383245_1001383248 -9 Left 1001383245 5:171317687-171317709 CCCATTAAGTAGGAAGTTGAGAA No data
Right 1001383248 5:171317701-171317723 AGTTGAGAAGCAGAGAAGGCAGG No data
1001383240_1001383248 20 Left 1001383240 5:171317658-171317680 CCATTGATCCCCTAAAACAGTTC No data
Right 1001383248 5:171317701-171317723 AGTTGAGAAGCAGAGAAGGCAGG No data
1001383242_1001383248 11 Left 1001383242 5:171317667-171317689 CCCTAAAACAGTTCTGTGTTCCC No data
Right 1001383248 5:171317701-171317723 AGTTGAGAAGCAGAGAAGGCAGG No data
1001383243_1001383248 10 Left 1001383243 5:171317668-171317690 CCTAAAACAGTTCTGTGTTCCCA No data
Right 1001383248 5:171317701-171317723 AGTTGAGAAGCAGAGAAGGCAGG No data
1001383246_1001383248 -10 Left 1001383246 5:171317688-171317710 CCATTAAGTAGGAAGTTGAGAAG No data
Right 1001383248 5:171317701-171317723 AGTTGAGAAGCAGAGAAGGCAGG No data
1001383241_1001383248 12 Left 1001383241 5:171317666-171317688 CCCCTAAAACAGTTCTGTGTTCC No data
Right 1001383248 5:171317701-171317723 AGTTGAGAAGCAGAGAAGGCAGG No data
1001383238_1001383248 25 Left 1001383238 5:171317653-171317675 CCATCCCATTGATCCCCTAAAAC No data
Right 1001383248 5:171317701-171317723 AGTTGAGAAGCAGAGAAGGCAGG No data
1001383237_1001383248 28 Left 1001383237 5:171317650-171317672 CCACCATCCCATTGATCCCCTAA No data
Right 1001383248 5:171317701-171317723 AGTTGAGAAGCAGAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001383248 Original CRISPR AGTTGAGAAGCAGAGAAGGC AGG Intergenic
No off target data available for this crispr