ID: 1001387640

View in Genome Browser
Species Human (GRCh38)
Location 5:171353187-171353209
Sequence GGCCCTCTGGGGCCTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001387640_1001387649 15 Left 1001387640 5:171353187-171353209 CCTGGCCCAGGCCCCAGAGGGCC No data
Right 1001387649 5:171353225-171353247 GGAGAGGCGAAGCCAGCAAGAGG No data
1001387640_1001387650 18 Left 1001387640 5:171353187-171353209 CCTGGCCCAGGCCCCAGAGGGCC No data
Right 1001387650 5:171353228-171353250 GAGGCGAAGCCAGCAAGAGGTGG No data
1001387640_1001387646 -6 Left 1001387640 5:171353187-171353209 CCTGGCCCAGGCCCCAGAGGGCC No data
Right 1001387646 5:171353204-171353226 AGGGCCTGAAAGAGAACATTCGG No data
1001387640_1001387648 -1 Left 1001387640 5:171353187-171353209 CCTGGCCCAGGCCCCAGAGGGCC No data
Right 1001387648 5:171353209-171353231 CTGAAAGAGAACATTCGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001387640 Original CRISPR GGCCCTCTGGGGCCTGGGCC AGG (reversed) Intergenic
No off target data available for this crispr