ID: 1001389235

View in Genome Browser
Species Human (GRCh38)
Location 5:171365531-171365553
Sequence GCGTCGTATGGCCCCCTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001389235_1001389240 7 Left 1001389235 5:171365531-171365553 CCATAGAGGGGGCCATACGACGC No data
Right 1001389240 5:171365561-171365583 GATTCTCATCTTAACTTAAAGGG No data
1001389235_1001389239 6 Left 1001389235 5:171365531-171365553 CCATAGAGGGGGCCATACGACGC No data
Right 1001389239 5:171365560-171365582 GGATTCTCATCTTAACTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001389235 Original CRISPR GCGTCGTATGGCCCCCTCTA TGG (reversed) Intergenic
No off target data available for this crispr