ID: 1001389838

View in Genome Browser
Species Human (GRCh38)
Location 5:171369920-171369942
Sequence TCCCTAGACCTCACACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001389834_1001389838 -7 Left 1001389834 5:171369904-171369926 CCCCTCAAAAGAACCATCCCTAG No data
Right 1001389838 5:171369920-171369942 TCCCTAGACCTCACACAGACAGG No data
1001389832_1001389838 13 Left 1001389832 5:171369884-171369906 CCTGAAGCTGGAGAAAGAACCCC No data
Right 1001389838 5:171369920-171369942 TCCCTAGACCTCACACAGACAGG No data
1001389835_1001389838 -8 Left 1001389835 5:171369905-171369927 CCCTCAAAAGAACCATCCCTAGA No data
Right 1001389838 5:171369920-171369942 TCCCTAGACCTCACACAGACAGG No data
1001389831_1001389838 16 Left 1001389831 5:171369881-171369903 CCACCTGAAGCTGGAGAAAGAAC No data
Right 1001389838 5:171369920-171369942 TCCCTAGACCTCACACAGACAGG No data
1001389836_1001389838 -9 Left 1001389836 5:171369906-171369928 CCTCAAAAGAACCATCCCTAGAC No data
Right 1001389838 5:171369920-171369942 TCCCTAGACCTCACACAGACAGG No data
1001389833_1001389838 -6 Left 1001389833 5:171369903-171369925 CCCCCTCAAAAGAACCATCCCTA No data
Right 1001389838 5:171369920-171369942 TCCCTAGACCTCACACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001389838 Original CRISPR TCCCTAGACCTCACACAGAC AGG Intergenic
No off target data available for this crispr