ID: 1001395328

View in Genome Browser
Species Human (GRCh38)
Location 5:171415327-171415349
Sequence AGCTACACAGCGGGTCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001395328_1001395333 5 Left 1001395328 5:171415327-171415349 CCACCATGACCCGCTGTGTAGCT No data
Right 1001395333 5:171415355-171415377 CAGTACTAGCTTAATGAGCAAGG No data
1001395328_1001395335 26 Left 1001395328 5:171415327-171415349 CCACCATGACCCGCTGTGTAGCT No data
Right 1001395335 5:171415376-171415398 GGAGAGATGAGCATTGTATAGGG No data
1001395328_1001395334 25 Left 1001395328 5:171415327-171415349 CCACCATGACCCGCTGTGTAGCT No data
Right 1001395334 5:171415375-171415397 AGGAGAGATGAGCATTGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001395328 Original CRISPR AGCTACACAGCGGGTCATGG TGG (reversed) Intergenic
No off target data available for this crispr