ID: 1001395329

View in Genome Browser
Species Human (GRCh38)
Location 5:171415330-171415352
Sequence AAGAGCTACACAGCGGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001395329_1001395334 22 Left 1001395329 5:171415330-171415352 CCATGACCCGCTGTGTAGCTCTT No data
Right 1001395334 5:171415375-171415397 AGGAGAGATGAGCATTGTATAGG No data
1001395329_1001395337 29 Left 1001395329 5:171415330-171415352 CCATGACCCGCTGTGTAGCTCTT No data
Right 1001395337 5:171415382-171415404 ATGAGCATTGTATAGGGCGTGGG No data
1001395329_1001395335 23 Left 1001395329 5:171415330-171415352 CCATGACCCGCTGTGTAGCTCTT No data
Right 1001395335 5:171415376-171415398 GGAGAGATGAGCATTGTATAGGG No data
1001395329_1001395336 28 Left 1001395329 5:171415330-171415352 CCATGACCCGCTGTGTAGCTCTT No data
Right 1001395336 5:171415381-171415403 GATGAGCATTGTATAGGGCGTGG No data
1001395329_1001395333 2 Left 1001395329 5:171415330-171415352 CCATGACCCGCTGTGTAGCTCTT No data
Right 1001395333 5:171415355-171415377 CAGTACTAGCTTAATGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001395329 Original CRISPR AAGAGCTACACAGCGGGTCA TGG (reversed) Intergenic
No off target data available for this crispr