ID: 1001395333

View in Genome Browser
Species Human (GRCh38)
Location 5:171415355-171415377
Sequence CAGTACTAGCTTAATGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001395329_1001395333 2 Left 1001395329 5:171415330-171415352 CCATGACCCGCTGTGTAGCTCTT No data
Right 1001395333 5:171415355-171415377 CAGTACTAGCTTAATGAGCAAGG No data
1001395328_1001395333 5 Left 1001395328 5:171415327-171415349 CCACCATGACCCGCTGTGTAGCT No data
Right 1001395333 5:171415355-171415377 CAGTACTAGCTTAATGAGCAAGG No data
1001395331_1001395333 -4 Left 1001395331 5:171415336-171415358 CCCGCTGTGTAGCTCTTGGCAGT No data
Right 1001395333 5:171415355-171415377 CAGTACTAGCTTAATGAGCAAGG No data
1001395332_1001395333 -5 Left 1001395332 5:171415337-171415359 CCGCTGTGTAGCTCTTGGCAGTA No data
Right 1001395333 5:171415355-171415377 CAGTACTAGCTTAATGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001395333 Original CRISPR CAGTACTAGCTTAATGAGCA AGG Intergenic
No off target data available for this crispr