ID: 1001399707

View in Genome Browser
Species Human (GRCh38)
Location 5:171439241-171439263
Sequence GCACCTTGGTATTCTGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001399701_1001399707 15 Left 1001399701 5:171439203-171439225 CCCTTAGTGAAATCTGCTTGGAT 0: 1
1: 0
2: 0
3: 7
4: 144
Right 1001399707 5:171439241-171439263 GCACCTTGGTATTCTGCAAGAGG No data
1001399702_1001399707 14 Left 1001399702 5:171439204-171439226 CCTTAGTGAAATCTGCTTGGATG 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1001399707 5:171439241-171439263 GCACCTTGGTATTCTGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001399707 Original CRISPR GCACCTTGGTATTCTGCAAG AGG Intronic
No off target data available for this crispr