ID: 1001400608

View in Genome Browser
Species Human (GRCh38)
Location 5:171444230-171444252
Sequence ACTCACTCGCTCCCCAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 261}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001400602_1001400608 -2 Left 1001400602 5:171444209-171444231 CCCCTGCCTCCTTCGCTGTTCAC 0: 1
1: 1
2: 1
3: 33
4: 318
Right 1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG 0: 1
1: 0
2: 0
3: 31
4: 261
1001400605_1001400608 -8 Left 1001400605 5:171444215-171444237 CCTCCTTCGCTGTTCACTCACTC 0: 1
1: 0
2: 4
3: 38
4: 383
Right 1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG 0: 1
1: 0
2: 0
3: 31
4: 261
1001400600_1001400608 28 Left 1001400600 5:171444179-171444201 CCAAAGAAAGTGGGGTCAAAGAG 0: 1
1: 0
2: 2
3: 15
4: 209
Right 1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG 0: 1
1: 0
2: 0
3: 31
4: 261
1001400603_1001400608 -3 Left 1001400603 5:171444210-171444232 CCCTGCCTCCTTCGCTGTTCACT 0: 1
1: 0
2: 2
3: 14
4: 269
Right 1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG 0: 1
1: 0
2: 0
3: 31
4: 261
1001400604_1001400608 -4 Left 1001400604 5:171444211-171444233 CCTGCCTCCTTCGCTGTTCACTC 0: 1
1: 1
2: 1
3: 18
4: 214
Right 1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG 0: 1
1: 0
2: 0
3: 31
4: 261
1001400601_1001400608 1 Left 1001400601 5:171444206-171444228 CCTCCCCTGCCTCCTTCGCTGTT 0: 1
1: 0
2: 5
3: 54
4: 702
Right 1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG 0: 1
1: 0
2: 0
3: 31
4: 261
1001400599_1001400608 29 Left 1001400599 5:171444178-171444200 CCCAAAGAAAGTGGGGTCAAAGA 0: 1
1: 1
2: 1
3: 32
4: 501
Right 1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG 0: 1
1: 0
2: 0
3: 31
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001400608 Original CRISPR ACTCACTCGCTCCCCAGGAA AGG Intronic
900487321 1:2929336-2929358 CCACACTCTCTCCCCAGGGAGGG - Intergenic
900940120 1:5793230-5793252 ACTGCCTCCCTCCCCTGGAAAGG + Intergenic
902044854 1:13516572-13516594 ACTCACCCCCTCTCCAGGAAGGG + Intergenic
902118903 1:14144860-14144882 ACACACTCACCCCACAGGAAAGG + Intergenic
902842002 1:19080632-19080654 GCTCCGTAGCTCCCCAGGAAAGG + Intronic
903138905 1:21326916-21326938 ACACCCCCGCTCCCCAGCAAGGG + Intronic
906579580 1:46925401-46925423 AATCATTCACTCCCCTGGAAAGG - Intergenic
906679214 1:47713721-47713743 ACTCCCACGCTCCCCCCGAAGGG - Intergenic
907023928 1:51096028-51096050 TCTCTCTCTCTCTCCAGGAATGG - Intergenic
909898782 1:81108096-81108118 ACCCACTAGCTCCCCAGCAATGG - Intergenic
910892223 1:92030032-92030054 GCTCACCCGCTCCCGAGGAAGGG + Exonic
912150495 1:106853400-106853422 AATCATTCACTCCCCTGGAAAGG + Intergenic
912211283 1:107559939-107559961 ACTCACTCACCACCAAGGAAGGG + Intergenic
913250863 1:116910721-116910743 ATTCTCTCGCTTCCCTGGAAAGG - Intronic
913465093 1:119132381-119132403 TCTGACTCTCTCCCCAGGACTGG + Intronic
916545652 1:165801590-165801612 AACCATTCGCTCCCCTGGAAAGG + Intronic
918931716 1:190863578-190863600 GCCCACTAGCTCCCCAGCAATGG - Intergenic
919281498 1:195495586-195495608 TCACACTGGCTCCCCAGCAATGG - Intergenic
919845405 1:201639299-201639321 CCTCGCTGGCTTCCCAGGAAAGG - Intronic
920231005 1:204469500-204469522 ACTCACTCTCCCCACAGGAAGGG - Exonic
922380424 1:225018030-225018052 TCACACTAGCTCTCCAGGAAAGG + Intronic
922572861 1:226644171-226644193 AGTCACTCACTGCCCAGGAGAGG + Intronic
1062833709 10:623100-623122 CCTCACTGGCTCCCTGGGAAGGG - Intronic
1063641354 10:7833835-7833857 AAGCCCTCGGTCCCCAGGAAGGG - Intronic
1064701059 10:18022660-18022682 CCACACTAGCTCCCCAGTAATGG - Intronic
1064722445 10:18243609-18243631 ACTCACTCATCCCCGAGGAAGGG - Intronic
1066159634 10:32714550-32714572 AACCATTCGCTCCCCTGGAAAGG + Intronic
1066462466 10:35623966-35623988 ACTCACTCACTACCATGGAAGGG + Intergenic
1067493995 10:46746017-46746039 TCTCACTAGCTCCCTAGGAAAGG - Intergenic
1067600667 10:47594387-47594409 TCTCACTAGCTCCCTAGGAAAGG + Intergenic
1068238097 10:54264384-54264406 TCTCACTAGCTCCCTAGAAAAGG + Intronic
1069045326 10:63737180-63737202 ACTCACACACACCCCAGGAAGGG - Intergenic
1069199969 10:65601381-65601403 TCACACTAGCTCCCCAGCAATGG - Intergenic
1070292053 10:75123560-75123582 ACTCCCACCCTCACCAGGAAAGG - Intronic
1071230289 10:83578795-83578817 GCCCACTAGCTCCCCAGCAATGG - Intergenic
1071652200 10:87402259-87402281 TCTCACTAGCTCCCTAGGAAAGG + Intergenic
1072044854 10:91644295-91644317 AACCACTCACTCCCCTGGAAAGG + Intergenic
1072535304 10:96358016-96358038 ACTCACAACCTCCCCATGAAGGG + Intronic
1072871763 10:99127109-99127131 TCACACTAGCTCCCCAGCAATGG + Intronic
1074759266 10:116654217-116654239 TCACACTAGCTCCCCAGCAATGG - Intergenic
1074945779 10:118279214-118279236 CCTCTCTCCCTCCCCAGGGAGGG + Intergenic
1075228653 10:120651997-120652019 ACTCCCTAGCTCCTAAGGAATGG + Intergenic
1075361687 10:121842347-121842369 ATTCACTCAGTCTCCAGGAAAGG - Intronic
1075731967 10:124641713-124641735 CCTCTCTGGCTCCCAAGGAAGGG - Intronic
1076519709 10:131073867-131073889 GCACACACGCTCCCAAGGAAAGG - Intergenic
1077547795 11:3183371-3183393 ACTCACTCTCTCCCTTGGGAGGG + Intergenic
1078336279 11:10465878-10465900 AATCATTCACTCCCCTGGAAAGG + Intronic
1078699916 11:13669803-13669825 ACTCACTCCCTCCGAAGTAATGG + Intronic
1079043147 11:17077472-17077494 ACTGCTTCTCTCCCCAGGAAGGG - Exonic
1079464065 11:20712505-20712527 TCACACTAGCTCCCCAGCAATGG - Intronic
1079814459 11:25038675-25038697 GCTCACTAGCTCCACAGCAATGG - Intronic
1080933260 11:36836377-36836399 ACACACTAGTTCCCCAGAAATGG - Intergenic
1081342578 11:41946487-41946509 ACTCACACACTCTTCAGGAATGG + Intergenic
1083965291 11:66040018-66040040 ACTCACTTATCCCCCAGGAAGGG - Intergenic
1089670820 11:120055908-120055930 CCTCACTCCCACCCCAGGAAGGG + Intergenic
1090407587 11:126486385-126486407 AGTCTCTCGCTCCGCAGGACTGG - Intronic
1092609058 12:10153133-10153155 GCACACTAGCTCCCCAGCAATGG - Intergenic
1092628977 12:10358515-10358537 AATCATTCACTCCCCTGGAAAGG - Intergenic
1093714473 12:22366087-22366109 AACCACTCACTCCCCTGGAAAGG + Intronic
1095777119 12:46022749-46022771 TCACACTAGCTCCCCAGCAATGG - Intergenic
1097654460 12:62343401-62343423 AACCATTCGCTCCCCTGGAAAGG - Intronic
1099373288 12:81865252-81865274 GCCCACTAGCTCCCCAGCAATGG - Intergenic
1099618546 12:84972158-84972180 AGTCACTTGCTCCCGAGGAAAGG + Intergenic
1100778271 12:97996088-97996110 ATTCACTCACCCCCAAGGAAGGG - Intergenic
1102483282 12:113238725-113238747 ACCCACTCGCTCCCCAGCACCGG + Intronic
1102545962 12:113655726-113655748 TTTCCCTCCCTCCCCAGGAATGG - Intergenic
1103169181 12:118799131-118799153 AATCATTCACTCCCCTGGAAAGG - Intergenic
1104521621 12:129480943-129480965 ATTCACCTGCTCCCCAGCAAAGG - Intronic
1106060068 13:26281603-26281625 CCACACTAGCTCCCCAGCAATGG + Intronic
1110491914 13:76119119-76119141 TCACACTCACTCCCCAGCAATGG + Intergenic
1112620177 13:101046919-101046941 AACCACTCACTCCCCTGGAAAGG - Intergenic
1114694208 14:24611750-24611772 TCACACTAGCTCCCCAGCAATGG - Intergenic
1115048723 14:29029367-29029389 AACCACTCACTCCCCTGGAAAGG - Intergenic
1117240815 14:53830308-53830330 TCACACTAGCTCCCCAGCAATGG + Intergenic
1117624199 14:57618689-57618711 AACCACTCACTCCCCTGGAAAGG + Intronic
1117761181 14:59030581-59030603 ACTCACTCGCCCCAGAGGGAGGG - Intergenic
1118500192 14:66355205-66355227 TCTCACTCCCTTTCCAGGAAGGG - Intergenic
1119182640 14:72614942-72614964 TCTTTCTCCCTCCCCAGGAATGG + Intergenic
1122124607 14:99572256-99572278 AGTCCCTCCCTCCCCAGGGATGG + Intronic
1123455993 15:20426736-20426758 ATCCACTAGCTCCCCAGCAATGG - Intergenic
1123635577 15:22304101-22304123 ATCCACTAGCTCCCCAGCAATGG + Intergenic
1124139455 15:27064450-27064472 GCCCACTGGCTCCTCAGGAAAGG + Intronic
1127139926 15:55964874-55964896 ACTCACTCACTTCCGAGGGAGGG - Intronic
1127290959 15:57570639-57570661 ACTCACTCACCCCCAAGAAAGGG - Intergenic
1127838031 15:62806499-62806521 ACTCACTTCCTCACCAGGGATGG - Intronic
1128088014 15:64899018-64899040 ACCCACTCCTTCCCCAGGCAGGG - Intronic
1129161187 15:73748830-73748852 ACTCTCTCGTCCCCCAGGCAGGG - Intronic
1131551129 15:93357937-93357959 ACTCCATGGCTTCCCAGGAAAGG - Intergenic
1133270262 16:4607883-4607905 CCGCACTTGCTTCCCAGGAATGG - Intergenic
1134770485 16:16804943-16804965 AGTCTCTCACTTCCCAGGAAAGG + Intergenic
1135202294 16:20448772-20448794 ACTCACTCACTCCCTAGGGAGGG - Intergenic
1135216810 16:20579094-20579116 ACTCACTCACTCCCTAGGGAGGG + Intergenic
1135574879 16:23577817-23577839 ACTCACTCGCTCCACACACAAGG - Intergenic
1135919530 16:26636371-26636393 ACTCACTCACCCCTGAGGAATGG + Intergenic
1136393411 16:29979300-29979322 ACTCACTCACTCACCAGTATGGG - Exonic
1138151523 16:54661812-54661834 AATCATTCACTCCCCTGGAAAGG + Intergenic
1138729692 16:59181685-59181707 TCACACTAGCTCCCCAGCAATGG - Intergenic
1138891398 16:61148791-61148813 CCTCGCTAGCTCCCCAGCAATGG - Intergenic
1142875448 17:2849517-2849539 ACCCACTGGCCCCTCAGGAACGG + Intronic
1144029121 17:11304111-11304133 ACCCTATCGCTCACCAGGAAAGG - Intronic
1144369875 17:14579893-14579915 AATCACTCTCTACCAAGGAAGGG - Intergenic
1145966018 17:28917835-28917857 CCACACTCCCTTCCCAGGAAGGG + Intronic
1147845969 17:43404035-43404057 AAGCTCTCACTCCCCAGGAAGGG - Intergenic
1148969598 17:51468268-51468290 TCTCACTCTCTCCCCAGGATGGG + Intergenic
1149619608 17:58033554-58033576 ACTCACTCACCCTCAAGGAAGGG + Intergenic
1149934652 17:60792636-60792658 ACTCACTCACTCCCTAGGGAGGG - Intronic
1151226591 17:72652539-72652561 ACTCACCCTCACCCCAGGACAGG - Intronic
1151376775 17:73694629-73694651 ACCCACTCCCTCCCCAGGACAGG - Intergenic
1152366417 17:79859181-79859203 CCTCACTCCCTCCCCTGAAAGGG - Intergenic
1152498117 17:80688884-80688906 ACTCACTCGCCCACCAGGCTTGG - Intronic
1153212868 18:2787249-2787271 ATTCACTCACTCCCAAGGGATGG + Intronic
1153828874 18:8901802-8901824 CCACACTGGCTCCCCAGCAAGGG + Intergenic
1154411144 18:14142916-14142938 CTCCACTCTCTCCCCAGGAATGG + Intergenic
1157897563 18:51483464-51483486 TCCCACTGGCTCCCCAGTAATGG - Intergenic
1160622109 18:80178893-80178915 CCTCACTCCCTCCCCAGAAGAGG - Intronic
1164945861 19:32292519-32292541 AATCACTAGCTCCCCAGGCTGGG + Intergenic
1165709606 19:38000814-38000836 ACTCATTCTCTCCCCACCAAAGG - Intronic
1166708094 19:44919753-44919775 ACTCACTCTCTCCCCCAGGATGG + Intergenic
1167721438 19:51182803-51182825 TCTCCCTCCCTCCCCAGGACCGG - Intergenic
1167763538 19:51463967-51463989 TCTCCCTCCCTCCCCAGGACCGG + Intergenic
925313198 2:2902476-2902498 CCTCACTCCCACTCCAGGAAAGG + Intergenic
926799883 2:16650965-16650987 ACTCACTCGCCCCCGTTGAATGG - Intronic
928321215 2:30284061-30284083 ACTCATGCACTCCCCAGCAAGGG + Intronic
929062932 2:37941884-37941906 AACCACTCACTCCCCTGGAAAGG - Intronic
929877157 2:45806325-45806347 ACCCACCCGCTCCCCAAGCAGGG + Intronic
930942289 2:57027575-57027597 TCACACTAGCTCTCCAGGAATGG - Intergenic
931814806 2:65890117-65890139 AGTCATTCACTCCCCTGGAAAGG + Intergenic
933340855 2:81024776-81024798 TCACACTAGCTCCCCAGCAATGG - Intergenic
934690659 2:96356268-96356290 ACTCACTGAATTCCCAGGAAAGG - Intronic
937143104 2:119618736-119618758 AACCACTCACTCCCCTGGAAAGG + Intronic
937391223 2:121488360-121488382 CCTCACTGGCTCCTCAGCAAAGG + Intronic
937498578 2:122451596-122451618 TCTCACTAGCTCCCAAGCAATGG + Intergenic
939078113 2:137627204-137627226 ACTCACTCTCCCCCAAGGGAGGG + Intronic
939888328 2:147705905-147705927 ACTCACTCACCCCCAAGGGAGGG + Intergenic
941518748 2:166511569-166511591 AATCATTCACTCCCCTGGAAAGG - Intergenic
941560798 2:167041288-167041310 CCACACTAGCTCCCCAGCAATGG + Intronic
945329753 2:208525519-208525541 AACCATTCGCTCCCCTGGAAAGG - Intronic
945338159 2:208617607-208617629 TCACACTAGCTCCCCAGCAATGG - Intronic
948773741 2:240269165-240269187 TCACACTAGCTCCCCAGCAATGG - Intergenic
1170567305 20:17614496-17614518 AGACACTCGCTTCCCAGCAAGGG + Intronic
1170865433 20:20151018-20151040 CCACACTAGCTCCCCAGCAATGG + Intronic
1171020651 20:21581607-21581629 ACTCACTCACTCCCATGGGAGGG + Intergenic
1171265020 20:23764242-23764264 TCTCACTATCTCCCCAGCAATGG + Intergenic
1172032607 20:31992439-31992461 GCTCACACGCTCCCCAGGACAGG - Intronic
1172032614 20:31992491-31992513 GCTCACACGCTGCCCAGGACAGG - Intronic
1173584086 20:44168907-44168929 ACTCACTCACCCCCAAGGGAGGG - Intronic
1176861911 21:14015499-14015521 CTCCACTCTCTCCCCAGGAATGG - Intergenic
1177184217 21:17775732-17775754 AACCATTCGCTCCCCTGGAAAGG - Intergenic
1177657375 21:24035830-24035852 CCACACTAGCTCCCCAGCAATGG + Intergenic
1178390668 21:32195511-32195533 ACTCACTAGGTCTCCAGGGAGGG - Intergenic
1180535419 22:16390511-16390533 ACTCCCACTCACCCCAGGAAGGG - Intergenic
1181615489 22:24051461-24051483 AGTCTCTCTCTCTCCAGGAAGGG + Intronic
1182001194 22:26921209-26921231 ACTCACTCACTCCCGAGGGAAGG - Intergenic
1182306290 22:29371236-29371258 TCTCATTCTCTCCGCAGGAATGG + Intronic
1183329359 22:37211285-37211307 ACTCACTGGCACCCCAGGCCTGG + Intronic
1183368755 22:37420511-37420533 GCGCCCTCGCTCCACAGGAAGGG + Intronic
1184192350 22:42903246-42903268 ACGCACACCCTCCCCAGGGAAGG - Intronic
949661579 3:6284755-6284777 TCACACTAGCTCCCCAGCAATGG + Intergenic
951238008 3:20257422-20257444 TCACACTAGCTCCCCAGCAATGG - Intergenic
951310883 3:21125005-21125027 AATCATTCACTCCCCTGGAAAGG + Intergenic
951614132 3:24522508-24522530 TCTCACTCAGACCCCAGGAAAGG - Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
955445927 3:59009293-59009315 TCACACTAGCTCCCCAGCAATGG + Intronic
955449278 3:59049901-59049923 ACACAATCACTCCCCAGGGACGG - Intronic
956383090 3:68686446-68686468 AACCACTCACTCCCCCGGAAAGG - Intergenic
957681469 3:83440869-83440891 TCACACTAGCTCCCCAGCAATGG + Intergenic
957777147 3:84767882-84767904 TCACACTAGCTCCCCAGCAATGG + Intergenic
959093097 3:101925033-101925055 AACCATTCGCTCCCCTGGAAAGG - Intergenic
962435627 3:135363986-135364008 ACTCACTGTCACCCCAGGATAGG - Intergenic
962505992 3:136046723-136046745 TCTCACTAGCTCCCCAGCAATGG + Intronic
962530408 3:136275456-136275478 TCACACTAGCTCCCCAGCAATGG - Intronic
964753625 3:160074970-160074992 ACTCAGTCGCAACCCTGGAAGGG - Intergenic
964816334 3:160720829-160720851 ACACACTAGTTCCCCAGAAATGG + Intergenic
965017381 3:163174868-163174890 AATCATTCACTCCCCTGGAAAGG + Intergenic
966008171 3:175042878-175042900 ACTCACTAACTCCCTAGGGAGGG - Intronic
967659661 3:192091166-192091188 CCTCACTAGTTCCCCAGCAATGG + Intergenic
968255769 3:197269842-197269864 ACTCACGTGTTCCACAGGAACGG - Intronic
968337606 3:197926719-197926741 ACGCCCTGACTCCCCAGGAAAGG - Intronic
968565504 4:1310576-1310598 ACTCATTTGCTCACCAGCAAGGG + Intronic
969700343 4:8764452-8764474 CCTCACTAGCCCCCCGGGAAGGG - Intergenic
970304697 4:14719092-14719114 AATCATTCACTCCCCTGGAAAGG + Intergenic
970685225 4:18559566-18559588 AATCATTCACTCCCCTGGAAGGG + Intergenic
971127923 4:23774779-23774801 ACTCTCCCTCTCCCCATGAAGGG - Intronic
971431693 4:26574711-26574733 ACTCACTCACCCCCAAGGGAGGG + Intergenic
971906405 4:32732191-32732213 ACTCACTGCCTCCCTTGGAAGGG - Intergenic
972363577 4:38351554-38351576 CCACACTAGCTCCCCAGCAATGG + Intergenic
974912333 4:68137680-68137702 ACTCACTCCCTTCCCAGCCATGG - Intergenic
975290788 4:72676608-72676630 TCACACTAGCTCCCCAGCAATGG - Intergenic
976794495 4:88917333-88917355 ACTCACTCACTTCCAAGGGAGGG + Intronic
977169537 4:93743685-93743707 ACTCACTCATCCCCAAGGAAGGG + Intronic
977731926 4:100363962-100363984 ACTCACAGGATCCCCAGGGAAGG - Intergenic
977887858 4:102273095-102273117 AATCATTCACTCCCCTGGAAAGG + Intronic
978287275 4:107094207-107094229 GCCCAATCGCTCCCCAGCAATGG - Intronic
979096018 4:116552668-116552690 TCTCACTAGTTCCCCAGCAATGG - Intergenic
979159962 4:117447666-117447688 TCACACTAGCTCCCCAGCAATGG - Intergenic
979819409 4:125151844-125151866 AATCATTCACTCCCCTGGAAAGG - Intergenic
979966007 4:127077331-127077353 AACCATTCACTCCCCAGGAAAGG - Intergenic
980151689 4:129055763-129055785 AATTACTCACTCCCCTGGAAAGG - Intronic
981367020 4:143915072-143915094 TCTCACTAGCTCACCAGCAATGG + Intergenic
981376816 4:144025310-144025332 TCTCACTAGCTCACCAGCAATGG + Intergenic
981387318 4:144146656-144146678 TCTCACTAGCTCACCAGCAATGG + Intergenic
983785034 4:171719430-171719452 CCACACTCGCTCCCCAGAAATGG + Intergenic
986318807 5:6610885-6610907 ACTCACCAGCTCACCAGGGATGG + Intronic
986581632 5:9272014-9272036 AATCATTCACTCCCCTGGAAAGG + Intronic
986617761 5:9637951-9637973 ACACACCGGCTCCCCAGCAATGG - Intronic
987456174 5:18149889-18149911 ATTCACTTGCTCCCAAGGAAAGG - Intergenic
988889609 5:35600201-35600223 TCACACTAGCTCCCCAGCAATGG + Intergenic
991281747 5:64922647-64922669 TCACACTAGCTCCCCAGCAATGG - Intronic
992977728 5:82138216-82138238 AATCATTCACTCCCCTGGAAAGG - Intronic
993410508 5:87567517-87567539 AATCATTCGCTCCCCTGGAAAGG - Intergenic
993581090 5:89661699-89661721 ACTCACTCATTCCCAAGGGAGGG - Intergenic
995205084 5:109470411-109470433 ACTCACTCACCCCCAAGGAAGGG - Intergenic
995535384 5:113130638-113130660 ACTCACTCACCCACAAGGAAGGG - Intronic
995645885 5:114310872-114310894 ACACACTCGCTCCCAGAGAAAGG - Intergenic
997021600 5:130008584-130008606 ACCCACTAGCTCCCCAGCAATGG + Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998635337 5:143948600-143948622 ACACACTAGCTCCCTAGCAATGG - Intergenic
999416831 5:151405585-151405607 TCACACTAGCTCCCCAGCAAAGG - Intergenic
1000548039 5:162625858-162625880 AACCATTCACTCCCCAGGAAAGG + Intergenic
1001042313 5:168345486-168345508 ACTCAATCACACCCAAGGAATGG - Intronic
1001362696 5:171103591-171103613 AATCATTCACTCCCCTGGAAAGG - Intronic
1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG + Intronic
1003516985 6:6825854-6825876 ACTCATTCTCAACCCAGGAACGG + Intergenic
1003667101 6:8121578-8121600 ACTCACTCACCTCCAAGGAAGGG - Intergenic
1004006478 6:11641734-11641756 ACCCACTAACTCCCCATGAATGG - Intergenic
1004712766 6:18188046-18188068 ACTCACACGTTCCTCAGGGAGGG - Intronic
1004852252 6:19712247-19712269 ACTCACTCACCTCCCAGGATGGG + Intergenic
1005378253 6:25207383-25207405 AATCATTCACTCCCCTGGAAAGG + Intergenic
1007890996 6:45291411-45291433 ACACACTGGCTCACCAGCAATGG + Intronic
1008208816 6:48695265-48695287 GCCCACTAGCTCCCCAGTAATGG + Intergenic
1009045810 6:58236715-58236737 ACCCAATAGCTCCCCAGCAATGG - Intergenic
1009221624 6:60991028-60991050 ACCCAATAGCTCCCCAGCAATGG - Intergenic
1009264087 6:61531942-61531964 AACCACTCACTCCCCTGGAAAGG + Intergenic
1009880484 6:69560619-69560641 AACCATTCACTCCCCAGGAAAGG + Intergenic
1010015414 6:71100571-71100593 TCACACTAGCTCCCCAGCAATGG - Intergenic
1010181789 6:73095452-73095474 TCACACTAGCTCCCCAGCAATGG - Intronic
1010707163 6:79128390-79128412 ACTCACTACCTCTCCAGCAAGGG + Intergenic
1011564419 6:88659259-88659281 TCACACTAGCTCCCCAGCAATGG + Intronic
1012203328 6:96433614-96433636 TCACACTAGCTCCCCAGCAATGG - Intergenic
1013929703 6:115516269-115516291 AACCACTCACTCCCCTGGAAAGG + Intergenic
1016664556 6:146621399-146621421 ACCCAATTGCTCCCCTGGAAAGG + Intronic
1017741081 6:157407271-157407293 ACTCACTCCCTTCCCAGGGGCGG - Intronic
1018147057 6:160901151-160901173 CCACACTAGCTCCCCAGCAATGG + Intergenic
1018781672 6:167073549-167073571 CCACACTAGCTCCCCAGCAATGG - Intergenic
1024840134 7:53575609-53575631 TCACACTAGCTCACCAGGAATGG + Intergenic
1024847699 7:53667628-53667650 TCACACTAGCTCCCCAGCAATGG - Intergenic
1028197244 7:87921071-87921093 TCACACTTGCTCCCCAGTAATGG + Intergenic
1030944038 7:115694063-115694085 ACTCACTCACTATCCAAGAACGG + Intergenic
1030958826 7:115889299-115889321 AATCATTCACTCCCCCGGAAAGG + Intergenic
1032922528 7:136566334-136566356 AATCACTAGCTCACCAGCAATGG - Intergenic
1033440152 7:141371239-141371261 ACTCACTTACCCCCAAGGAAGGG - Intronic
1034551390 7:151822828-151822850 ACTCCCTCCCTCCCCACAAAAGG + Intronic
1034735486 7:153425540-153425562 ACTCACTTGCCCCCAAGGGAGGG - Intergenic
1035347855 7:158217573-158217595 ACACACTAGCTACCCAGCAATGG + Intronic
1035640994 8:1185041-1185063 AGTGACTCGTTTCCCAGGAAAGG + Intergenic
1039830465 8:41209657-41209679 ACTCCCTCACTCCCAAGGAAAGG - Intergenic
1041560671 8:59214870-59214892 TCTCACTAGCTCCCCAGCAATGG - Intergenic
1042084310 8:65090540-65090562 CCACACTAGCTCCCCAGCAATGG + Intergenic
1045280753 8:100747559-100747581 ACTCACTCGGCCACCCGGAATGG - Intergenic
1047720510 8:127634778-127634800 ACTCAAGCTCTGCCCAGGAAAGG + Intergenic
1049869682 8:144965026-144965048 TCACACTAGCTCCCCAGCAATGG - Intergenic
1049987975 9:970145-970167 CCTCACGCGGTCCCCTGGAAGGG + Intergenic
1050234421 9:3562872-3562894 ACCCATTCACTCCCCTGGAAAGG - Intergenic
1051616845 9:19014760-19014782 ATTCAGTTGTTCCCCAGGAACGG - Intronic
1051671170 9:19512165-19512187 ACTCTCTCCCTGCCCAGGAATGG + Exonic
1053146224 9:35713947-35713969 ACTTACTGTCTCCCCAGGTAAGG + Exonic
1053419436 9:37967910-37967932 ACTCAGTCCCTCCCGAGGATTGG - Intronic
1054966056 9:71027424-71027446 ACACACTAGTTCCCCAGCAAGGG + Intronic
1055369542 9:75582440-75582462 CCACACTCGCCCCCCAGGGACGG - Intergenic
1055388237 9:75788149-75788171 ACACACTAGCTCCCCAGTAATGG - Intergenic
1057543053 9:95993827-95993849 TCTCCCTCTCTCCCCAGAAAAGG + Intronic
1059284866 9:113163590-113163612 ACTTATTCTCTCCCCAAGAAAGG - Exonic
1060403028 9:123359198-123359220 ACTCACTCAGTCATCAGGAAAGG - Intronic
1060851661 9:126881886-126881908 ACTCACTCGCACTTAAGGAAAGG + Exonic
1061984412 9:134121620-134121642 ACTCACTCACCCCCGAGGGAGGG + Intergenic
1062183395 9:135203148-135203170 ACTCCCTCTCTCCCCAGGGCAGG + Intergenic
1189773678 X:44451140-44451162 TCACACTGGCTCCCCAGGAAGGG + Intergenic
1192021824 X:67402023-67402045 TCACACTAGCTCCCCAGCAATGG - Intergenic
1192412334 X:70945033-70945055 ACTCACTCACCCCCAAGGGAGGG - Intergenic
1192694172 X:73397415-73397437 GCCCACTAGCTCCCCAGCAATGG - Intergenic
1192759218 X:74078042-74078064 ACCCATTCACTCCCCTGGAAAGG - Intergenic
1193113793 X:77756337-77756359 ACCCATTCACTCCCCTGGAAAGG - Intronic
1193364077 X:80609425-80609447 ACACACTAGTTCCCCAGCAATGG + Intergenic
1193423039 X:81307777-81307799 TCACACTAGCTCCCCAGCAATGG - Intergenic
1193671175 X:84388828-84388850 ACCCACTAGCTCCCCAGCAATGG - Intronic
1194089979 X:89574043-89574065 TCACACTAGCTCTCCAGGAATGG - Intergenic
1194146205 X:90267688-90267710 ATTCACTCACACCCCACGAATGG - Intergenic
1194601371 X:95924927-95924949 ACACACTAGCTCACCAGCAATGG + Intergenic
1198277669 X:135112009-135112031 ACTTACTAGCTCCCCAGCAATGG - Intergenic
1198586473 X:138127944-138127966 GTTCACTAGCTCCCCAGCAATGG - Intergenic
1199854033 X:151745108-151745130 CCTCACTCCCTGCCCTGGAATGG - Exonic
1200442625 Y:3230097-3230119 TCACACTAGCTCTCCAGGAATGG - Intergenic
1200491949 Y:3836959-3836981 ATTCACTCACACCCCACGAATGG - Intergenic