ID: 1001400975

View in Genome Browser
Species Human (GRCh38)
Location 5:171446306-171446328
Sequence TGCGGTGGCCCTGGCTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 6, 3: 28, 4: 350}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001400964_1001400975 12 Left 1001400964 5:171446271-171446293 CCCTTTGGACAGCTCAGGCAAAG 0: 1
1: 0
2: 0
3: 17
4: 241
Right 1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG 0: 1
1: 0
2: 6
3: 28
4: 350
1001400961_1001400975 18 Left 1001400961 5:171446265-171446287 CCCAGGCCCTTTGGACAGCTCAG 0: 1
1: 0
2: 0
3: 14
4: 188
Right 1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG 0: 1
1: 0
2: 6
3: 28
4: 350
1001400962_1001400975 17 Left 1001400962 5:171446266-171446288 CCAGGCCCTTTGGACAGCTCAGG 0: 1
1: 0
2: 2
3: 47
4: 886
Right 1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG 0: 1
1: 0
2: 6
3: 28
4: 350
1001400959_1001400975 25 Left 1001400959 5:171446258-171446280 CCTCTGCCCCAGGCCCTTTGGAC 0: 1
1: 1
2: 18
3: 104
4: 562
Right 1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG 0: 1
1: 0
2: 6
3: 28
4: 350
1001400960_1001400975 19 Left 1001400960 5:171446264-171446286 CCCCAGGCCCTTTGGACAGCTCA 0: 1
1: 0
2: 1
3: 27
4: 231
Right 1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG 0: 1
1: 0
2: 6
3: 28
4: 350
1001400965_1001400975 11 Left 1001400965 5:171446272-171446294 CCTTTGGACAGCTCAGGCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 202
Right 1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG 0: 1
1: 0
2: 6
3: 28
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001400975 Original CRISPR TGCGGTGGCCCTGGCTGGTG AGG Intronic
900238976 1:1605763-1605785 TGCGGTGGGCTGGGCTGGTCAGG + Intergenic
900239175 1:1606438-1606460 TGCGGTGGGCTGGGCTGGTCAGG + Intergenic
900346813 1:2214121-2214143 TGTGGTGGCCTTGACTGGAGAGG + Intergenic
900351544 1:2237333-2237355 TGCGGTGCTCCTGGCTGCTGTGG + Intronic
900880507 1:5377971-5377993 TCAGGGGGCTCTGGCTGGTGGGG + Intergenic
900953949 1:5875459-5875481 TGTTGGGGACCTGGCTGGTGAGG - Intronic
901413693 1:9102944-9102966 TGCTGTTGCCCAGGCTGGAGTGG + Exonic
901676058 1:10885858-10885880 TTCGGTTGCCCAGGCTGGAGTGG - Intergenic
901688793 1:10959443-10959465 TGGGGTGGCACTGGCTGCAGAGG - Intronic
903045475 1:20561343-20561365 TGCTGTTGCCCAGGCTGGAGTGG - Intergenic
903929800 1:26855603-26855625 TGCAGTGGCCCTGGGAGGTGAGG + Exonic
904253639 1:29240951-29240973 CGTGGTGGCCCTGGCAGATGGGG + Intronic
904328182 1:29740950-29740972 TGATGAGCCCCTGGCTGGTGAGG + Intergenic
904374076 1:30068758-30068780 TCCTGTGGCCCTGGCTGGCCTGG - Intergenic
904385868 1:30141732-30141754 TCAGGTGGCCCTGGCTGATGGGG - Intergenic
904972427 1:34429515-34429537 TGAGGTGGCACGGGCTGCTGTGG - Intergenic
905894088 1:41534102-41534124 GGTGGTGGCCAGGGCTGGTGGGG - Intronic
906111036 1:43322034-43322056 TGCTCTGGCTCTGGCAGGTGGGG - Intronic
911101799 1:94101377-94101399 TGCCCAGGCCCTGGGTGGTGCGG - Intronic
912649282 1:111423792-111423814 TGTGGTGGGCCTGGCAGATGTGG + Intronic
915313005 1:155013792-155013814 TGGGGTGTCACTGGCTGGCGCGG - Intronic
915524781 1:156468849-156468871 TGCTGTGGCTGTGGCTGCTGTGG + Exonic
915844907 1:159252749-159252771 CGTGGTGGACCTGCCTGGTGAGG - Intergenic
916502828 1:165401239-165401261 TGGGGAGGCTGTGGCTGGTGGGG + Exonic
917055641 1:170978460-170978482 GCCAGGGGCCCTGGCTGGTGAGG + Intronic
918224885 1:182472290-182472312 TGCAGTGGAACAGGCTGGTGGGG + Intronic
920281626 1:204847811-204847833 AGCGGTGGGCATGGGTGGTGAGG + Intronic
921012978 1:211161379-211161401 TGTGGAGGACCTGCCTGGTGAGG + Intergenic
921993901 1:221396620-221396642 TGCTGTAGCCCTTGATGGTGAGG - Intergenic
922241079 1:223755826-223755848 TGCAGTGGCTCTGGGTTGTGGGG + Intronic
922874630 1:228930662-228930684 TGTGGTGTCCCTGTCTGCTGCGG + Intergenic
923592190 1:235328608-235328630 TGCGGTGTCGCTGGCGGCTGAGG + Exonic
924181733 1:241445823-241445845 TGAGGTGGCCCTGGGCAGTGAGG - Intergenic
924555891 1:245118325-245118347 TGCGCTGGGCTTGGCTGGGGAGG + Intronic
1062761807 10:28209-28231 TGGGGAGGCCCTGTCCGGTGAGG - Intergenic
1064418208 10:15168613-15168635 CGCGGCGGCGCTGGCTGGGGAGG + Exonic
1065220568 10:23491977-23491999 TGCTGTTGCCCAGGCTGGTCTGG + Intergenic
1065858583 10:29851021-29851043 GAAGGTAGCCCTGGCTGGTGAGG - Intergenic
1066194079 10:33081633-33081655 TGGGGAGGCCCTTGGTGGTGGGG + Intergenic
1067015713 10:42755205-42755227 AGCGGTGGCCAGGGCTGATGGGG + Intergenic
1067286506 10:44911363-44911385 TGCGGTGGCCAGGACTGGTTTGG + Exonic
1067704422 10:48596430-48596452 TGGGGTGGGGCTGGCTGGAGGGG + Intronic
1067851588 10:49758356-49758378 TGCGGTGGCCCAGGGTAGGGTGG + Intronic
1070449260 10:76541462-76541484 TCCTGTCGCCCTGGCTGGAGCGG - Intronic
1071776391 10:88792914-88792936 TGCGGTTTCCCTGGCTGGTGTGG - Intergenic
1072319145 10:94232100-94232122 AGTGGTGGTCCTGTCTGGTGAGG + Intronic
1072614143 10:97038287-97038309 AGCGGTGGCACTGGCTGCAGAGG - Intronic
1073311858 10:102548712-102548734 AGAGCTGGGCCTGGCTGGTGGGG - Intronic
1074581663 10:114724867-114724889 TCTGGTGGCTCTGCCTGGTGTGG - Intergenic
1074864568 10:117537319-117537341 TGCGCGGGCCCTGCCTGGGGTGG - Intergenic
1075020386 10:118947942-118947964 TGCGCTGGCTGTGGCTGGTTTGG - Intergenic
1075077244 10:119359596-119359618 TGCTGTGGCCCTGGCTGCTGTGG + Intronic
1075102404 10:119515719-119515741 TCCTGTGGGCCTGGCTGGAGGGG - Intronic
1076406531 10:130215674-130215696 AGGTGTGGCCTTGGCTGGTGGGG + Intergenic
1076546606 10:131249520-131249542 TGCGTTTGCCATGGCTGGAGAGG - Intronic
1076749939 10:132537595-132537617 TGCGGGGGGCGTGGCTTGTGCGG - Intergenic
1077209259 11:1360904-1360926 TGCTGTGGGCCTGGGTGCTGTGG + Intergenic
1077318129 11:1928295-1928317 TGGGGTGGACCTGGCTGGCCTGG - Intronic
1077411433 11:2405670-2405692 AGCGGGGGCCCTGGCAGGAGAGG - Intronic
1078212584 11:9282345-9282367 TGCTGTTGCCCAGGCTGGAGTGG - Exonic
1078447647 11:11416698-11416720 TGTGGTGGCTGTGGTTGGTGTGG - Intronic
1079128115 11:17733068-17733090 TGGTGTGGCCCGGCCTGGTGTGG - Intergenic
1079256280 11:18834210-18834232 TGTGGTGGGCCTGCCTGGTCTGG - Intergenic
1079374524 11:19880072-19880094 TGATGTGGCGCTGGCTGGTGAGG - Exonic
1079706887 11:23632555-23632577 TACTGTGGCCCTAGGTGGTGAGG - Intergenic
1080408997 11:32005817-32005839 TGCAGAGGCCGTGGCGGGTGAGG - Intronic
1083899011 11:65634738-65634760 TGCAGTGGCCCTTCCTGTTGGGG + Intronic
1083996429 11:66275331-66275353 AGAGGTGGCCCTGGCCTGTGGGG - Intronic
1084409233 11:68996909-68996931 TGCAGAGGCCCTGGCAGGCGGGG - Intergenic
1084711766 11:70847957-70847979 TGAGGTGACCGTGGCTGGAGGGG + Intronic
1085051334 11:73381748-73381770 GACCATGGCCCTGGCTGGTGTGG + Intronic
1085766878 11:79291078-79291100 TGTGGTGGCTCTGGGTGGAGTGG + Intronic
1086898086 11:92336367-92336389 TGTGGTCGCCCTGTCTGCTGTGG - Intergenic
1089304175 11:117516435-117516457 GGCAGGGGCCCTGGCTGGTGAGG + Intronic
1089352674 11:117830307-117830329 TGCGGAGGTCCTGGAGGGTGAGG - Intronic
1089599743 11:119605970-119605992 TGAGGAGCCCCTGGCTGATGAGG - Intergenic
1089613337 11:119681655-119681677 TGGGCTGCCCCTGCCTGGTGAGG - Intronic
1089774053 11:120823881-120823903 TGCTCTGGCCCTGGAGGGTGGGG - Intronic
1090211478 11:124923753-124923775 GGCTGCGGCCCTGGCTGATGGGG + Exonic
1090321173 11:125844900-125844922 TAGGGAGGCCCTGCCTGGTGAGG - Intergenic
1091726208 12:2848349-2848371 GGTGTTGGCCCTGGCTGGGGTGG - Intronic
1091882455 12:3990721-3990743 GGCGGGGGCCCAGGCTGCTGTGG + Intergenic
1092525260 12:9305882-9305904 TGCAGTGGGCCTTGCTGGGGTGG + Intergenic
1092945324 12:13449213-13449235 GGAGGTGGCGCTGGCTGGAGAGG - Intergenic
1094510996 12:31096504-31096526 TGCAGTGGGCCTTGCTGGGGTGG + Intronic
1096491414 12:52015017-52015039 TGCGCGGGCCCTGGCGGGGGCGG + Exonic
1096515217 12:52151981-52152003 TGCAGAGGGCGTGGCTGGTGTGG + Intergenic
1101269939 12:103132783-103132805 TGCGGTAGCGGTGGCTGCTGTGG - Intergenic
1102257458 12:111424570-111424592 TGCCGTAGCCCTGGCTGGCTGGG + Intronic
1103191893 12:119008762-119008784 CCCGTTGGCTCTGGCTGGTGGGG - Intronic
1103727224 12:123004132-123004154 TGCTGTGGGCCTGGCAGATGGGG - Intronic
1104063948 12:125291058-125291080 TGCGGTGGCACTGGAAAGTGGGG + Intronic
1104878533 12:132053421-132053443 AGCGGTGGCGGTGGCTGCTGCGG - Exonic
1106703964 13:32260786-32260808 TGCTGTTGCCCAGGCTGGAGTGG - Intronic
1111041803 13:82758046-82758068 GTAGGTGGGCCTGGCTGGTGTGG + Intergenic
1112908177 13:104449731-104449753 TGCTGTTGCCCAGGCTGGAGTGG + Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1115028366 14:28767378-28767400 TGTGGTGGCCGTGGCTCGCGTGG - Exonic
1119484999 14:74981308-74981330 TGTGTTGGCTTTGGCTGGTGAGG + Intergenic
1119764857 14:77181916-77181938 TGCGGTGACCGGGGCTGGTCGGG + Intronic
1121657405 14:95607296-95607318 TGCTGGGGCCCAGGCTGGCGTGG - Intergenic
1121755228 14:96396883-96396905 TGTTGTTGCCCAGGCTGGTGTGG - Intronic
1122482199 14:102054500-102054522 TTGGGTGGCCCTGGCGGTTGGGG - Intergenic
1122494040 14:102139590-102139612 TCCGCTGGCCCTGGCGGCTGCGG + Exonic
1122939654 14:104975544-104975566 TGCGGTCACCCTGCCTGGTGGGG + Intronic
1123034529 14:105466529-105466551 TGCGCTTGCCCAGGATGGTGGGG - Exonic
1123995029 15:25712420-25712442 TGGAGTGGCCCTGGCATGTGGGG - Intronic
1125717464 15:41827474-41827496 TGCGGTGGGCGCGGCTGGTGTGG - Exonic
1125964598 15:43863757-43863779 TGCTGTTGCCCAGGCTGGTCTGG + Intronic
1128926452 15:71660640-71660662 GGTGGTAGCCCAGGCTGGTGAGG - Exonic
1129251724 15:74312906-74312928 GGCTGAGGCCCTGCCTGGTGGGG - Intronic
1130014247 15:80174929-80174951 TGCTGGGGGCCTGGCTGGTATGG + Intronic
1130551947 15:84895019-84895041 GGCGGTGGCCCAGGAAGGTGAGG - Exonic
1131540824 15:93273588-93273610 AGAGGTGGCCCATGCTGGTGGGG + Intergenic
1132394282 15:101460403-101460425 TGGGCTGGCCCTGGAGGGTGAGG - Intronic
1132731939 16:1367008-1367030 GGGGAGGGCCCTGGCTGGTGCGG - Intronic
1132751294 16:1459077-1459099 TGCGGTGGCCCTGGCTGGGCAGG - Intronic
1132812745 16:1809429-1809451 TGCAGTGGCCCTGGCTCCTCCGG - Intronic
1132851037 16:2025176-2025198 TTGGGTGGACCTGGTTGGTGTGG + Intergenic
1132880603 16:2160226-2160248 TGCGTTGGCCCCAGCTGGAGGGG + Intronic
1132953358 16:2577416-2577438 TGAGTTGGCCCTGGCTGCAGAGG - Exonic
1132960992 16:2622752-2622774 TGAGTTGGCCCTGGCTGCAGAGG + Intergenic
1134008496 16:10834233-10834255 TGGTGTGGCCCGGGCTGGAGAGG - Intergenic
1134415970 16:14043685-14043707 TGAGGTGGCCCTAGCTCCTGAGG + Intergenic
1134514903 16:14879242-14879264 GTCGGAGGCCCTGACTGGTGGGG + Intronic
1134702580 16:16277891-16277913 GTCGGAGGCCCTGACTGGTGGGG + Intronic
1134964963 16:18434224-18434246 GTCGGAGGCCCTGACTGGTGGGG - Intronic
1134969250 16:18516759-18516781 GTCGGAGGCCCTGACTGGTGGGG - Intronic
1136365376 16:29806909-29806931 CGCGGCGGCCCGGGCTGGGGGGG + Intronic
1136366906 16:29813178-29813200 TGCGGGGCCTCTGGCTGGTCTGG - Exonic
1137444486 16:48523437-48523459 GAGGCTGGCCCTGGCTGGTGAGG + Intergenic
1138105413 16:54285061-54285083 TGAGCTGTCCCTGGCTGGGGCGG - Exonic
1138184045 16:54962914-54962936 TGTGGTGGCCATGGGTGGAGGGG + Intergenic
1138428363 16:56951427-56951449 AGCGGTGGCCCTGGCTGGCTAGG + Intergenic
1138590703 16:57998207-57998229 TGCGGTGGCTGTGGCTGCTGCGG + Exonic
1140151364 16:72370478-72370500 TACAGTGGCACTGGCTGCTGTGG + Intergenic
1140406845 16:74716960-74716982 TGCCGTGCCCCTGGCTAGAGGGG + Intronic
1140411298 16:74742209-74742231 TGTGGTGGGCCTGGCTGTGGGGG + Intronic
1140535005 16:75701975-75701997 TGAGGTTGCCCTGGAGGGTGGGG + Intronic
1140536312 16:75713186-75713208 TTCGGTGGGGCTGGCTGCTGAGG + Intronic
1140700251 16:77574987-77575009 TTCAGTGGCCCTGGTTGCTGTGG + Intergenic
1141149099 16:81551971-81551993 CAGGGGGGCCCTGGCTGGTGGGG + Intronic
1141684642 16:85563404-85563426 TGCGGAGGGCCTGGCATGTGTGG - Intergenic
1142029266 16:87830492-87830514 TGCGGTGGCCCTGGTCCCTGTGG + Exonic
1142250462 16:88989562-88989584 AGCGGGGGCGCTGCCTGGTGGGG + Intergenic
1142289299 16:89185454-89185476 TGCAGTGGCCCTGGCTCCTGAGG + Intronic
1142670171 17:1484440-1484462 TGCGGGGGGCCTGGGTGCTGAGG + Intronic
1143476974 17:7208423-7208445 TGCTGAGGCCCTGGCGGGAGAGG - Intronic
1143543453 17:7582870-7582892 TGCTGGGGCCCTGCCAGGTGAGG - Intergenic
1144399930 17:14886505-14886527 TGCTCAGCCCCTGGCTGGTGGGG + Intergenic
1144626356 17:16846212-16846234 TGAGGTGGGCCGGGCTGGGGTGG - Intergenic
1144880076 17:18426507-18426529 TGAGGTGGGCCGGGCTGGGGTGG + Intergenic
1145152157 17:20517877-20517899 TGAGGTGGGCCGGGCTGGGGTGG - Intergenic
1147400538 17:40177952-40177974 TGCGGTGGGCCTGGAGGGGGTGG + Intronic
1147535064 17:41315502-41315524 TGCGGGGGCTCTGGCTGCGGGGG - Exonic
1147611198 17:41802879-41802901 TGCTGCTGCCCAGGCTGGTGAGG + Exonic
1147968487 17:44206967-44206989 TGGGGTGGGCCAGGCTGGTCCGG + Exonic
1148213888 17:45824139-45824161 GGCCTTGGCCTTGGCTGGTGGGG + Intronic
1148836387 17:50467965-50467987 AGCTGTGGCCCTGGCTCCTGGGG + Intronic
1149006420 17:51810853-51810875 TGCAGTGGCCTTGTCTGGTGTGG - Intronic
1149108423 17:52997103-52997125 TGCCGTAGCCCTGGATGGTGAGG - Intergenic
1149568208 17:57654085-57654107 TGCGCTAACCCAGGCTGGTGTGG - Intronic
1150766646 17:68007614-68007636 TGCTGTTGCCCAGGCTGGTCTGG + Intergenic
1151348273 17:73516493-73516515 CTCTGGGGCCCTGGCTGGTGAGG - Intronic
1151766921 17:76137562-76137584 TGTGGCGGCCGTGGATGGTGAGG + Exonic
1152072734 17:78142006-78142028 GGCGGGGGCCCAGGCAGGTGAGG + Exonic
1152091304 17:78249343-78249365 TGCGGTGGCCCTGGTGGGACTGG - Intergenic
1152525583 17:80886652-80886674 TGGTGTGGCCCTGGCTGCTGAGG + Intronic
1152773772 17:82187513-82187535 GGAGGTGGCCGGGGCTGGTGGGG + Intronic
1152811509 17:82384865-82384887 TGAGGCGGCCCTGGCCGGGGAGG + Intergenic
1152905775 17:82970189-82970211 TGCTGTGGCCTTGGCTGGCCTGG - Intronic
1152954714 18:28539-28561 TGGGGAGGCCCTGTCCGGTGAGG - Intergenic
1153772183 18:8425116-8425138 TGCTGTGGGGCTGGCAGGTGGGG - Intergenic
1153992710 18:10414452-10414474 TGCGGTGGCTCTGGTGGGCGTGG - Intergenic
1153992724 18:10414517-10414539 TGCGGTGGCTCTGGTGGGCGTGG - Intergenic
1157402598 18:47400728-47400750 TGTGGTGGCCCTGGGTGGGAGGG - Intergenic
1157402724 18:47401228-47401250 TGTGGTGGCCCTGGGTGGGAGGG - Intergenic
1157402993 18:47402271-47402293 TGTGGTGGCCCTGGGTGGGAGGG - Intergenic
1157403028 18:47402396-47402418 TGTGGTGGCCCTGGGTGGGAGGG - Intergenic
1157403050 18:47402480-47402502 TGTGGTGGCCCTGGGTGGGAGGG - Intergenic
1157577107 18:48750708-48750730 TGGGGAGGCCGGGGCTGGTGAGG - Intronic
1160232247 18:77057232-77057254 TGCGGTCTCCCTGGCTGGCTGGG + Intronic
1160353049 18:78201401-78201423 TGCGGTGGCCCTGGCAGGAATGG - Intergenic
1160583767 18:79901683-79901705 TGCAGGGGCCGTGGCAGGTGGGG - Intergenic
1160584232 18:79903877-79903899 TGCTGTGGCCCCTGCAGGTGTGG - Exonic
1160726016 19:618123-618145 GGTGGTGGCCCTGGCAGGAGGGG - Intronic
1161000779 19:1909743-1909765 AGAGGAGGCCCTGGCTGGAGTGG - Intronic
1161003771 19:1924425-1924447 TTCTGTGGCCCTGGCAGGAGGGG - Exonic
1161046415 19:2137168-2137190 TGGGCTGGCGCTGCCTGGTGTGG - Intronic
1161073444 19:2273706-2273728 TGCGCAGGCCCAGGCTGGGGCGG - Intronic
1161251147 19:3281036-3281058 CGCTGTGGCCCTGGCTCCTGGGG + Intronic
1161857448 19:6773693-6773715 TGCAGGGGCCCAGGCTGGAGGGG + Intronic
1161979753 19:7624271-7624293 TCTGGGGGCCCCGGCTGGTGGGG - Intronic
1162805435 19:13135853-13135875 TGGGGTGGCGGGGGCTGGTGAGG - Exonic
1165373970 19:35428481-35428503 TGTGGTGGCTCTGCCAGGTGTGG - Intergenic
1165382658 19:35492097-35492119 GGCGGTGGCCCTGGGTGGGAGGG + Intronic
1165623428 19:37267139-37267161 TTTGGTGGCCCCGGCTGGTTAGG + Intergenic
1165844949 19:38812358-38812380 TGCTCTGGGCCTGGCTGTTGGGG - Intronic
1166158513 19:40933987-40934009 TGGGGTTACCCTGGCTTGTGGGG + Intergenic
1166167495 19:41002205-41002227 TGGGGTTACCCTGGCTTGTGGGG + Intronic
1166800882 19:45456202-45456224 TGGGGAGGCCCTGGCGGGTGAGG + Intronic
1166838734 19:45683342-45683364 AGCAGTGGCCCTGGCTGCTCTGG - Exonic
1167120576 19:47514301-47514323 TGCGTGGGCCCTGGGCGGTGAGG - Intronic
1167152690 19:47719032-47719054 TCCTCTGGCCCTGGCTGGCGGGG + Intronic
1167494454 19:49809438-49809460 TGCTGCTCCCCTGGCTGGTGGGG - Exonic
1167638604 19:50668431-50668453 TGCTGCTGCCCTGGCTGCTGCGG + Exonic
1168289237 19:55348994-55349016 AGCGGTGGCCCTGGGAGGCGGGG + Intergenic
1168325298 19:55535963-55535985 TGGGGTAGCCCAGGCTGGGGAGG - Intronic
1168457193 19:56521746-56521768 TGCTGTTGCCCAGGCTGGTCTGG - Intronic
927309868 2:21618030-21618052 TGCTGTAGCCCTCGGTGGTGAGG + Intergenic
927920910 2:26971074-26971096 TGCGGTGGCCACGTCTAGTGGGG - Intronic
929961229 2:46497793-46497815 TGAGCGTGCCCTGGCTGGTGAGG + Intronic
930692272 2:54376755-54376777 AGTGGTGGCCCTGGCTGTTGAGG - Intronic
932507574 2:72250880-72250902 TGCTGTTGCCCAGGCTGGAGTGG + Intronic
933772139 2:85751350-85751372 TGGGGTGCCCGTGGCTGGTGAGG - Intronic
934551741 2:95267091-95267113 TGCGGTGGACGTGGAAGGTGGGG + Intergenic
934923674 2:98366601-98366623 CGGGGAGGCCCTGCCTGGTGAGG + Intronic
935142730 2:100368212-100368234 TGCCTTTGCCCTGGCTTGTGTGG + Intergenic
936827024 2:116594280-116594302 TTCTGTCGCCCTGGCTGGAGTGG + Intergenic
937376867 2:121342961-121342983 TGCTGTTGCCCAGGCTGGTTTGG + Intronic
938086877 2:128407562-128407584 TGAGCTGGCCCTGGCTGAGGTGG + Intergenic
939460044 2:142487880-142487902 TGCTGTTGCCCAGGCTGGAGTGG - Intergenic
941337099 2:164259716-164259738 CTCTGTTGCCCTGGCTGGTGTGG - Intergenic
944159057 2:196639786-196639808 TGCCGGGCCCCGGGCTGGTGAGG + Intronic
946374144 2:219298010-219298032 TCTGGTGGCCCTGGCAGGTGTGG - Exonic
947748649 2:232522055-232522077 GGGCCTGGCCCTGGCTGGTGAGG + Exonic
948059650 2:235033407-235033429 TGTGATGGCACTGGCAGGTGGGG - Intronic
948462774 2:238138420-238138442 CGCGGTTGGGCTGGCTGGTGGGG - Intergenic
948676628 2:239600814-239600836 TGAGGTGGCCCTGGGGGATGTGG - Intergenic
948868653 2:240787510-240787532 TCAGGGGTCCCTGGCTGGTGTGG + Intronic
949072661 2:242035401-242035423 AGCTGTGGACCTGGCAGGTGGGG + Intergenic
1171214679 20:23343666-23343688 TGATGTTGCCCAGGCTGGTGTGG + Intergenic
1174339488 20:49886957-49886979 TGCGGTGGCCCAGGGTGGGGTGG + Intronic
1175106337 20:56617681-56617703 GGAGGTGGACCTGGCTGATGAGG + Intergenic
1175756417 20:61533216-61533238 GGCCGTGGCACTGGCTGTTGTGG - Intronic
1175895463 20:62333848-62333870 TGGGGTGGGCTGGGCTGGTGGGG + Intronic
1176110072 20:63407075-63407097 TGCCGTGGCCCTGGCGCGGGTGG + Exonic
1176238717 20:64066080-64066102 GGGTGTGGCCCTGGCTGCTGGGG + Intronic
1176408214 21:6433422-6433444 TGGTGTGGCCCTGGCTGCTATGG - Intergenic
1178163607 21:29946837-29946859 TATTGTGGCCCAGGCTGGTGGGG - Intergenic
1178830591 21:36053315-36053337 TAGGCTGACCCTGGCTGGTGGGG - Intronic
1178843747 21:36157343-36157365 TGCTGGTGCCCTGGCTGGGGAGG + Intronic
1178868725 21:36353392-36353414 TGCCGTGGCTCAGGCCGGTGCGG + Intronic
1179455361 21:41495814-41495836 TGGGTTTGCCCTGGCTTGTGTGG - Intronic
1179502346 21:41818105-41818127 TGTGGTGAGCCTGGCTGGAGGGG - Intronic
1179683705 21:43041748-43041770 TGGTGTGGCCCTGGCTGCTATGG - Intergenic
1179818320 21:43922161-43922183 TGTGGAGGCCCAGGCTTGTGGGG + Intronic
1179820680 21:43935232-43935254 TGTGGTGGCCTTGCGTGGTGAGG + Intronic
1180166127 21:46030637-46030659 TGCGGTGGTGCTGGGAGGTGGGG + Intergenic
1180211603 21:46298114-46298136 CGCCGTGGCCCTGGCTAGAGCGG - Intergenic
1180835523 22:18927667-18927689 TGAGGTGGGCCTGGCAGGAGAGG + Intronic
1181005251 22:20010375-20010397 TCTGGTGGGCCTGGCGGGTGGGG - Intronic
1181988736 22:26820563-26820585 TGTTTTGGCCCTGGCTGGGGGGG - Intergenic
1182590401 22:31375164-31375186 TTGTGTGGCCCAGGCTGGTGTGG - Intergenic
1182698409 22:32211765-32211787 TGGGATGGCCCTGGCCAGTGAGG - Intergenic
1183264751 22:36818285-36818307 TGTGGTGGCCCTGGGTGGTGGGG + Intronic
1183678743 22:39314476-39314498 TGTGGTGGGGCTGACTGGTGTGG - Intronic
1184342279 22:43892437-43892459 TGCAGTGGTGCTGGCTGGAGCGG - Intergenic
1184523088 22:45007400-45007422 TCCGGCGGCCCGGGCTGGGGTGG + Intronic
1184785756 22:46670979-46671001 AGCGGTGACCCTGCCAGGTGTGG + Intronic
1185000684 22:48243762-48243784 TGGGGTGGCCATGGGTGGAGGGG - Intergenic
1185137057 22:49079143-49079165 CGACGTGGCCCTGCCTGGTGTGG + Intergenic
1185386314 22:50532632-50532654 AGCGGCGGCACTGGGTGGTGGGG - Intergenic
1203285611 22_KI270734v1_random:152966-152988 TGAGGTGGGCCTGGCAGGAGAGG + Intergenic
949875531 3:8623916-8623938 GGCAGTGACCATGGCTGGTGTGG + Intronic
950369200 3:12513919-12513941 TAGGGTGGCTCTGGCTGTTGGGG + Intronic
953244327 3:41176933-41176955 GGAGGTGAACCTGGCTGGTGGGG + Intergenic
953793394 3:45965386-45965408 TGGGGTGGCACTGGGTGGGGAGG + Intronic
953812982 3:46130342-46130364 GGGAGTGGCCCTGGCTGGAGTGG + Intergenic
954112228 3:48440470-48440492 CGCGGAGGCACTGGCGGGTGCGG + Intronic
954681477 3:52348453-52348475 TGCAGTGGCAGTGACTGGTGGGG - Intronic
954717458 3:52533725-52533747 CGCGGTGGGCATGGCGGGTGCGG - Exonic
954743668 3:52774451-52774473 GGCGGTGGCCTTGACTGGAGTGG + Intergenic
955397712 3:58569022-58569044 TGTGGTGGGCCCGTCTGGTGAGG - Intronic
956111998 3:65879116-65879138 GGCTGTGGGCCTGCCTGGTGGGG - Intronic
956421903 3:69094352-69094374 TACAGTGGCCCTGGCTGCAGAGG + Intronic
956601277 3:71025314-71025336 TTCGGTGGTTCTGGGTGGTGGGG + Intronic
957984553 3:87557185-87557207 TGTGGCTGCACTGGCTGGTGTGG - Intergenic
961180824 3:124875968-124875990 GGTGGTTGCCATGGCTGGTGGGG + Intronic
961202163 3:125053927-125053949 TGCAGGGGCCCTGGCTGGATGGG - Intronic
961385284 3:126519849-126519871 CCAGGTGGCCCTGGCTGGTGAGG - Intergenic
961450756 3:127001316-127001338 TCATGTGGCCCTGGCTGTTGGGG + Intronic
961552251 3:127676149-127676171 TGCGGTGGCCCTGGTGGGTGTGG + Intronic
962476607 3:135760648-135760670 TCCTGTGGCTCTTGCTGGTGAGG - Intergenic
963530566 3:146469434-146469456 TGGGGTGTGCCTGGCTAGTGGGG - Intronic
967307389 3:188072239-188072261 TGTGATGTCCCTGGCTGATGCGG - Intergenic
967838864 3:193987585-193987607 TAAGGTGGCCATGGATGGTGTGG + Intergenic
968161564 3:196431810-196431832 CGCCGTGGCCCTGGCGGGTTCGG - Intronic
968550803 4:1222614-1222636 GGCGGGGGCCCTGGCAGGTGGGG + Intronic
968552297 4:1229878-1229900 TGCTGTGGCCCTGGTCTGTGTGG - Intronic
968704965 4:2073453-2073475 CCTGGTGGCTCTGGCTGGTGGGG - Intronic
968966607 4:3772128-3772150 TGCCGTGGCACTTGCTGGCGAGG + Intergenic
969222919 4:5773059-5773081 TGCGGTGACCGAGGCAGGTGTGG - Intronic
969639449 4:8388227-8388249 AGCAGTGATCCTGGCTGGTGAGG - Intronic
969863231 4:10054009-10054031 TACAGGGGCCCTGGCTGATGTGG - Intronic
970225909 4:13856551-13856573 AGGGGTGGCCCTGCCTGGGGTGG - Intergenic
970321854 4:14882589-14882611 TGCAGTGGGGCTGGATGGTGGGG + Intergenic
972379884 4:38509871-38509893 TGAGATGGCCCTGGCTTTTGTGG + Intergenic
975832985 4:78389580-78389602 TGCGATGGCCCTGGGAGATGAGG + Intronic
976119837 4:81767911-81767933 TAAGATGGCCCTGGCTGGTATGG - Intronic
976235380 4:82891166-82891188 GGAGGTGGCCCTGGCCGGGGAGG - Exonic
980930361 4:139177733-139177755 TGCGGGGGCCCTGAGTGGCGAGG - Intergenic
983319456 4:166177559-166177581 CTCTGTGGCCCTGGCTGGAGTGG + Intergenic
985657450 5:1139577-1139599 GGCAGTGGCCCTAGCGGGTGTGG + Intergenic
985703960 5:1390075-1390097 AGCTGCGGCACTGGCTGGTGGGG - Intergenic
985812943 5:2103542-2103564 TGCTGTGGCCCTTACGGGTGAGG + Intergenic
985842387 5:2317910-2317932 TCCCCTGGCCCTGGCTGCTGTGG + Intergenic
986046403 5:4042459-4042481 TGCCATGGCACTGGCTGCTGTGG - Intergenic
987963241 5:24837788-24837810 TACGGTGGCCATGGCAGTTGTGG + Intergenic
988935947 5:36083128-36083150 TTGGGAGGCCCTGTCTGGTGAGG - Intergenic
989113360 5:37928499-37928521 TTCGGTGGCACTGGGAGGTGGGG - Intergenic
994168763 5:96636740-96636762 AGTGGTGGCTGTGGCTGGTGGGG + Intronic
999224557 5:150010350-150010372 TGTGGAGGCCCTGGCTGAGGAGG + Exonic
999430506 5:151521552-151521574 TGCAGAGGCCGTGGCTGGTGTGG - Exonic
999462510 5:151770079-151770101 TTCTGTCGCCCTGGCTGGAGTGG - Exonic
1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG + Intronic
1002589986 5:180283893-180283915 CGCTGTGGCCCAGGCTGGAGTGG - Intronic
1007588890 6:43009459-43009481 TGGGGTGGGGCTGGGTGGTGGGG + Intronic
1015808288 6:137133971-137133993 TGCAGTGGCCCTGGGTTCTGGGG - Intergenic
1016151067 6:140744108-140744130 TGTGGTAGCCCTTGGTGGTGAGG - Intergenic
1017726833 6:157282155-157282177 TTCTGTGGCCCAGGCTGGAGTGG + Intergenic
1017830096 6:158118977-158118999 TGCTGGGGCCCTGGTTGCTGGGG - Intronic
1018431761 6:163728538-163728560 TGTGGTGGCCTTGGTTGGAGAGG + Intergenic
1018926948 6:168213190-168213212 GGCGGTGGCTCTGTCTGGGGAGG - Intergenic
1018956903 6:168416314-168416336 TGCGGGGGCCGTGGCTGGGCAGG - Intergenic
1019255476 7:46986-47008 TGCGGTGGGCCTGGAGTGTGGGG + Intergenic
1019327435 7:445374-445396 TGACGGGGCGCTGGCTGGTGGGG - Intergenic
1019331798 7:463987-464009 TGCGGTGGGCATGGCGGGCGCGG + Intergenic
1019339237 7:500728-500750 TGCAGTTGCCCTGGCTGGCTGGG - Intronic
1023875416 7:44283890-44283912 TGGTGGGGCCCAGGCTGGTGGGG - Intronic
1024053522 7:45645355-45645377 TGCTGTGGGGCTGGCTGGGGTGG - Intronic
1027365688 7:77455534-77455556 TGCTGTGGCCCTGGCCAGAGCGG + Intergenic
1030266628 7:107628653-107628675 TCTGGTAGCTCTGGCTGGTGTGG + Intronic
1033028013 7:137795528-137795550 TGAGGTGGCCCTATCTGTTGCGG + Intronic
1033299828 7:140176369-140176391 GGCGGCGGCCCGGGCTGGCGAGG + Intronic
1033586654 7:142779459-142779481 TGCTGTGGCTCTGGCTGGTGTGG - Intergenic
1033670537 7:143488698-143488720 TGCGGTGCCCCTGGGTGGAGTGG + Intergenic
1034429320 7:151033322-151033344 TGCGAGGGCCCTGGCTGGCTGGG + Intronic
1034985309 7:155509669-155509691 CGCGATGGCCCGGGCTGGGGTGG + Intronic
1035244261 7:157551981-157552003 TGTGGTGGCCGTGGGTTGTGTGG - Intronic
1035315695 7:157996611-157996633 TGGGTTTGCTCTGGCTGGTGTGG + Intronic
1035572640 8:683193-683215 AGCGGTGGCTGTGGCTGGCGTGG + Intronic
1036274291 8:7336967-7336989 TGGGGTGTTCCCGGCTGGTGGGG + Intergenic
1036295062 8:7528721-7528743 CCCGGAGGCCCGGGCTGGTGAGG - Intergenic
1036327501 8:7792270-7792292 CCCGGAGGCCCGGGCTGGTGAGG + Intergenic
1036635647 8:10548197-10548219 TCAGGTGGGCCTGGCTGGAGTGG + Intronic
1036649672 8:10634367-10634389 TGCGGTTGTCCTGGAGGGTGGGG - Intronic
1036663838 8:10726180-10726202 TACGGGTGCCCTGGCAGGTGGGG + Exonic
1037910866 8:22742861-22742883 TGCGGTGTCCCTGTATGGGGCGG + Intronic
1038226529 8:25663291-25663313 TGTGGGGGCCCTGGCTGACGAGG + Intergenic
1039102587 8:33957274-33957296 TTGGGTGGCCCTGCCTAGTGAGG + Intergenic
1041412768 8:57574995-57575017 TGCAGAGGACGTGGCTGGTGGGG + Intergenic
1042871919 8:73407374-73407396 TTCTGTGGCCCAGGCTGCTGAGG - Intergenic
1047371150 8:124257150-124257172 GGAGGTGGCCCTGGCCTGTGGGG - Intergenic
1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG + Exonic
1048299196 8:133239009-133239031 TTCGGGTGCCCTCGCTGGTGTGG + Exonic
1048329794 8:133463803-133463825 TGCTGGGGCACTGGCTGGTGAGG + Intronic
1048606492 8:135973865-135973887 TGGGTTGGACCTGGCTGTTGGGG + Intergenic
1049433083 8:142574258-142574280 TCCGGCCGCCCTGGCTGTTGGGG - Intergenic
1049766553 8:144357952-144357974 AGCGGTGGCCCGGGCGGGGGCGG - Intronic
1049787180 8:144456552-144456574 TGGGGTCTTCCTGGCTGGTGGGG - Intronic
1052338132 9:27339812-27339834 TCCCGTGGCCCATGCTGGTGTGG - Intronic
1052902202 9:33802914-33802936 CGCTGTGGCCCTGGGTGATGAGG - Intergenic
1053053773 9:34981507-34981529 TGGGGTGGGCCTGGCTGGCCTGG - Exonic
1054813754 9:69455372-69455394 TGCTGAGGCCCAGGATGGTGCGG + Intronic
1056992449 9:91424046-91424068 GGCGGTGGCCCTGGCCGGGGAGG - Intergenic
1057019905 9:91689071-91689093 GGAGGTGGGCCTGGCTGGTTGGG - Intronic
1058226618 9:102371932-102371954 TGCTGTAGCCCTTGGTGGTGAGG + Intergenic
1060508434 9:124215338-124215360 TGAGGAGCCCATGGCTGGTGGGG - Intergenic
1060819238 9:126651929-126651951 CTCGATGGCCCTGGCTGGTAGGG - Intronic
1061273633 9:129557731-129557753 TGGGGTTGCCCTGGCAGGGGCGG - Intergenic
1061864621 9:133485863-133485885 TGCTCTCGGCCTGGCTGGTGTGG + Intergenic
1061897963 9:133658381-133658403 GGCTTCGGCCCTGGCTGGTGGGG - Exonic
1062494888 9:136827014-136827036 TGCTGTGCCCGGGGCTGGTGTGG + Intronic
1185461296 X:333780-333802 TGGGGTCCCCCTGGCTGGGGAGG + Intergenic
1191253040 X:58268388-58268410 TGCGCTGTCCCTGGCGGGGGGGG - Intergenic
1192091055 X:68156552-68156574 AGTGGTTGCCCAGGCTGGTGGGG - Intronic
1192434445 X:71134340-71134362 TGTTGTGGCCCTGGCAGGTGGGG + Exonic
1193112391 X:77743042-77743064 TGGGGTGGCTCTGCCTGGTGTGG + Intronic
1193907505 X:87261072-87261094 TGCTGTAGTCCTTGCTGGTGAGG - Intergenic
1195123044 X:101775713-101775735 CGCTGTAGCCCTGGGTGGTGAGG + Intergenic
1197433899 X:126401045-126401067 TGCAGTGGCTGTGGCTGGGGTGG + Intergenic
1198310140 X:135422167-135422189 TGCGGCGGCCCTGTCTGGCCTGG + Intergenic
1198311019 X:135425788-135425810 TGCAGTGGCCCCGGGTGGAGAGG + Intergenic
1199929377 X:152503158-152503180 GGGGATGGCCCTGGCTTGTGGGG + Intergenic