ID: 1001401523

View in Genome Browser
Species Human (GRCh38)
Location 5:171449187-171449209
Sequence CCGTCTCCTTGCCCTTGATC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001401523_1001401527 16 Left 1001401523 5:171449187-171449209 CCGGATCAAGGGCAAGGAGACGG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1001401527 5:171449226-171449248 GAACCGCAAAGGCAAGCTCGTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1001401523_1001401528 17 Left 1001401523 5:171449187-171449209 CCGGATCAAGGGCAAGGAGACGG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1001401528 5:171449227-171449249 AACCGCAAAGGCAAGCTCGTGGG 0: 1
1: 0
2: 1
3: 3
4: 31
1001401523_1001401525 5 Left 1001401523 5:171449187-171449209 CCGGATCAAGGGCAAGGAGACGG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1001401525 5:171449215-171449237 TACCTGTGCATGAACCGCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 41
1001401523_1001401531 22 Left 1001401523 5:171449187-171449209 CCGGATCAAGGGCAAGGAGACGG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1001401531 5:171449232-171449254 CAAAGGCAAGCTCGTGGGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 171
1001401523_1001401529 18 Left 1001401523 5:171449187-171449209 CCGGATCAAGGGCAAGGAGACGG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1001401529 5:171449228-171449250 ACCGCAAAGGCAAGCTCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001401523 Original CRISPR CCGTCTCCTTGCCCTTGATC CGG (reversed) Exonic
903232398 1:21929910-21929932 CGGCCTCCTTGCCTTTGCTCTGG + Intronic
903283584 1:22263788-22263810 CCGTGTCCCTGCCCCTGTTCTGG - Intergenic
905227244 1:36487248-36487270 CCGCCTCCTGGCCTTTGCTCAGG + Intergenic
912458941 1:109818546-109818568 CTGCCTCCTTGCCTCTGATCTGG + Intergenic
915870804 1:159557750-159557772 CCATCTCATTGCTCTTGGTCTGG - Intergenic
916189796 1:162167612-162167634 CCCTTTCCTTTCCCTTCATCAGG + Intronic
917640330 1:176977506-176977528 CCGGGTCCTTGTCCTGGATCAGG + Intronic
918039967 1:180908027-180908049 CTGTCTCCTTGCCTTTGCCCAGG - Intergenic
919991495 1:202710645-202710667 CAGCCTCCTTGACCTTGAGCAGG - Intergenic
920248121 1:204603579-204603601 TCATCTCCTTGCCCTTGCTGTGG + Intergenic
923104462 1:230843620-230843642 CCTTCTCCATGGACTTGATCTGG + Exonic
924801748 1:247332904-247332926 CCTTCTGCTTGCCCTTGAAAGGG - Intergenic
1066005229 10:31140837-31140859 CTGACTCCTTGCCCTTCATATGG + Intergenic
1067084561 10:43230918-43230940 CTGTCTCCAGGCCCTTGAGCTGG - Intronic
1076877956 10:133225821-133225843 ACGGCCCCTTGCCCTTGCTCAGG + Exonic
1077220985 11:1416101-1416123 CCCTCCCCTTGCCCTAGCTCGGG - Intronic
1078461149 11:11516101-11516123 CCGCCTTCTAGCCCCTGATCAGG + Intronic
1083208645 11:61168699-61168721 CCATCTCCTTCCCCTGCATCAGG + Intergenic
1083975408 11:66115477-66115499 CCATCTCCTTGCCCTGTATATGG + Intronic
1087240794 11:95775523-95775545 CCATCTCCTTTCCCATTATCTGG + Intronic
1090239822 11:125174154-125174176 CTGTCTCCCTGCCCTGGACCTGG - Intronic
1093469290 12:19483332-19483354 CCGTCTCGTCTCCCATGATCTGG + Intronic
1095334854 12:41012186-41012208 CTCTCTCTCTGCCCTTGATCTGG - Intronic
1096403101 12:51323792-51323814 CCTTATCCTTGCCCAAGATCGGG + Intronic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1100848426 12:98684220-98684242 CCGTCTCCATCCCCCTGTTCAGG + Intronic
1102617370 12:114166328-114166350 TGGTTTCCTTGCCCTTGATGTGG + Intergenic
1103952500 12:124558674-124558696 CAGTCTCCTTGCCATTGCTCAGG - Intronic
1105771591 13:23617321-23617343 CCCTCTCCTTTCCCTGGACCTGG - Intronic
1108357316 13:49639676-49639698 CCTCCTGCTTGCCCCTGATCTGG + Intergenic
1117119662 14:52553467-52553489 GCGGCTCCCTGCCCTTGCTCCGG + Exonic
1118302178 14:64625767-64625789 CTGTTTCCTTGCACTTGACCTGG + Intergenic
1118366537 14:65101951-65101973 CCGTCCCCTTCCCCTGGATCCGG + Intronic
1123061160 14:105595133-105595155 CTGACTCCTTGCCCTTGCTCTGG + Intergenic
1123085615 14:105716044-105716066 CTGACTCCTTGCCCTTGCTCTGG + Intergenic
1124401693 15:29354150-29354172 CCGTCTCTCTCCCCTTGAGCTGG + Intronic
1125549914 15:40537467-40537489 CTGTCTCCTACCCCTTGCTCTGG + Intronic
1126297138 15:47152704-47152726 CAGTCTCCTTGCTATTGATTTGG + Intergenic
1128354919 15:66919357-66919379 CTGCCTCCTTGCCCCTGCTCAGG - Intergenic
1135509489 16:23069857-23069879 TCGCCTCCTTGCCCTACATCAGG + Intronic
1138309276 16:56009400-56009422 CCGTCTCCTTGCATCTGAGCTGG + Intergenic
1141754893 16:85984284-85984306 CCTTCGCCCTGCCTTTGATCAGG - Intergenic
1141766024 16:86060582-86060604 CCGACTCCCTGCCCTTCAACAGG + Intergenic
1142766472 17:2067278-2067300 GAGTCTCCTTGTTCTTGATCCGG - Intronic
1144172501 17:12671947-12671969 CTGGCTCCTCCCCCTTGATCTGG - Intronic
1146258419 17:31405146-31405168 CCCTCTCCTTGCCCCTGAACTGG - Intronic
1149539926 17:57461152-57461174 GCTTCTCCCTGCCCTTGACCCGG + Intronic
1150388946 17:64780094-64780116 CGGTCTCCTGGCCCTTGGCCTGG - Intergenic
1150790500 17:68197826-68197848 CGGTCTCCTGGCCCCTGGTCCGG + Intergenic
1151288605 17:73132080-73132102 CCGTTTTCTTTCCCTAGATCGGG - Intergenic
1152854009 17:82653687-82653709 CGGTCTCCATGCCTTTGACCGGG - Intergenic
1159413417 18:68111375-68111397 CTGTCTCCTTGCCCCTTCTCTGG + Intergenic
1163439257 19:17313258-17313280 CGGTGTCCTTGCCTTTGATAGGG + Intronic
1167349858 19:48967895-48967917 CCTTCTCCTTCCCCTGGGTCTGG + Intergenic
928606309 2:32947443-32947465 CCGGCGCCTTGCCCCTGAGCGGG + Exonic
931965720 2:67532005-67532027 CAGTCTCCTTTCCTTTGGTCTGG - Intergenic
935951511 2:108334037-108334059 CCAACTCCTTGCCCTGCATCAGG + Intergenic
938368942 2:130756650-130756672 CCATCTCCTTGCCCCTGGGCAGG + Intronic
939166672 2:138648161-138648183 CCTTCCCCTTGCCCTTCATCAGG - Intergenic
948667746 2:239546775-239546797 CAGCCTCCTTGCCCCTGAGCAGG + Intergenic
1171356134 20:24547047-24547069 CCACCTCATTGCCCTTGTTCAGG + Intronic
1174845619 20:53940428-53940450 CCATCTCCTGGCCCTTTAACTGG - Intronic
1175270952 20:57733929-57733951 CTGTGTCCTTGCCCTTTTTCAGG + Intergenic
1176861256 21:14012690-14012712 CCCTCTCCTTACCCCTGCTCTGG + Intergenic
1178321501 21:31609592-31609614 CCTTCTCCAGGCCCTTGAGCTGG - Intergenic
952507911 3:34024380-34024402 TAGTATCCTTGCCCTTGAGCTGG + Intergenic
965241675 3:166208440-166208462 CTGTCTCCTTGCACTGGATCAGG + Intergenic
968592360 4:1465456-1465478 CCCTCTCCTGCCCCTTGCTCTGG - Intergenic
978847232 4:113288012-113288034 TCATCTCCATGCCCTTGGTCTGG + Intronic
982618570 4:157674978-157675000 CCGTCTGCATGCCCATGATTTGG - Intergenic
989199540 5:38750066-38750088 CCATCCCCTTGCCCTGGTTCTGG - Intergenic
992062219 5:73064478-73064500 CAGTCTATTTGCCTTTGATCTGG + Intronic
999868813 5:155729069-155729091 GGGTCTCCTTGCGCTTAATCTGG + Intergenic
1000014869 5:157267262-157267284 CCGTCTCCCTGCCCATGCTGAGG - Intronic
1000780534 5:165474590-165474612 CAGCCTCCTTGCCCTAGCTCAGG - Intergenic
1001401523 5:171449187-171449209 CCGTCTCCTTGCCCTTGATCCGG - Exonic
1001410202 5:171505908-171505930 GCATGTCCTTGCCCTTGCTCTGG + Intergenic
1002186235 5:177456081-177456103 CGGTCTCCATCCCCTTGTTCGGG + Exonic
1002526880 5:179820034-179820056 CCCTCTCCTTGCCCCAGTTCTGG + Intronic
1003810343 6:9772840-9772862 CAATCCCCTTGCCCTTCATCTGG - Intronic
1004454906 6:15783418-15783440 CCATCTCCGTGCCCATGATGAGG - Intergenic
1006147586 6:31968642-31968664 CCTTCTCCTTGCCCCTTAGCAGG - Intronic
1012535350 6:100289863-100289885 TCATCTCCTTTCCCATGATCTGG + Intergenic
1018291066 6:162292979-162293001 CCTCCTCCTTGCCCTTCATGAGG - Intronic
1019420339 7:947896-947918 CCGTCTCCCCGCCCTGGCTCTGG + Intronic
1022140365 7:27488103-27488125 CCTTCTCCTTGTCCTTCCTCTGG + Intergenic
1023966369 7:44965019-44965041 CGGCCACCTTGGCCTTGATCTGG + Exonic
1026447610 7:70499239-70499261 CCTTCTCCTTTCCCTTCAGCAGG - Intronic
1026499186 7:70928543-70928565 ACATCTCCTTTCCCTTGGTCTGG + Intergenic
1034075241 7:148225265-148225287 CCCTCTCCTTCCCCTTGGCCAGG - Intronic
1034437467 7:151070026-151070048 CCCTGTCCTCGGCCTTGATCTGG - Exonic
1035161079 7:156950178-156950200 CCGTGGCCTTGGCCTTGACCCGG - Exonic
1035208437 7:157310015-157310037 CCATCTCCGTGTCCCTGATCAGG - Intergenic
1040010324 8:42656368-42656390 CCCTCTCCATGCCCTGGCTCTGG + Intergenic
1041361460 8:57058981-57059003 TCCTCTCCTTGCCTTTGATGGGG - Intergenic
1045266333 8:100621760-100621782 CCGACTCTTTGCCATTGGTCAGG + Intronic
1045409950 8:101906801-101906823 GCCTCTCCATGCCCTTGCTCTGG - Intronic
1047729186 8:127712479-127712501 CTGTTTCCTTCCCCTGGATCTGG - Intergenic
1050072517 9:1830790-1830812 GCGTCTCCTTTCCCTTTATGTGG - Intergenic
1051729291 9:20122787-20122809 CTGTCTTCTTGCCCTTGTTTTGG + Intergenic
1058524187 9:105840583-105840605 CTGTCTCCTTCCCCTAGAACAGG - Intergenic
1059436376 9:114279040-114279062 CCGTCTCCCTGCCCCTGTACCGG + Intronic
1061529596 9:131200016-131200038 CCTTCTCCTTGCCCATTTTCTGG - Intronic
1187042996 X:15616748-15616770 CCATGTCCTTGCCCTTGGTCAGG - Intergenic
1192169973 X:68848134-68848156 CCGTCCCCTTGCCCGTTGTCTGG + Intergenic
1198285314 X:135184332-135184354 CTGTCTCCTAGACCTGGATCTGG - Intergenic