ID: 1001401761

View in Genome Browser
Species Human (GRCh38)
Location 5:171450460-171450482
Sequence CCTCATCTGTGGAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1229
Summary {0: 1, 1: 6, 2: 71, 3: 275, 4: 876}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001401761_1001401770 2 Left 1001401761 5:171450460-171450482 CCATCCCCATTCCACAGATGAGG 0: 1
1: 6
2: 71
3: 275
4: 876
Right 1001401770 5:171450485-171450507 GCCGAGGCTTGGCCACGCCCGGG No data
1001401761_1001401768 -9 Left 1001401761 5:171450460-171450482 CCATCCCCATTCCACAGATGAGG 0: 1
1: 6
2: 71
3: 275
4: 876
Right 1001401768 5:171450474-171450496 CAGATGAGGAAGCCGAGGCTTGG 0: 2
1: 15
2: 195
3: 868
4: 2240
1001401761_1001401773 15 Left 1001401761 5:171450460-171450482 CCATCCCCATTCCACAGATGAGG 0: 1
1: 6
2: 71
3: 275
4: 876
Right 1001401773 5:171450498-171450520 CACGCCCGGGCACTTGTCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 94
1001401761_1001401769 1 Left 1001401761 5:171450460-171450482 CCATCCCCATTCCACAGATGAGG 0: 1
1: 6
2: 71
3: 275
4: 876
Right 1001401769 5:171450484-171450506 AGCCGAGGCTTGGCCACGCCCGG 0: 1
1: 0
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001401761 Original CRISPR CCTCATCTGTGGAATGGGGA TGG (reversed) Intronic
900118352 1:1038175-1038197 CCCCAGCTGTGGAGTGGGGGTGG - Intronic
900168677 1:1255609-1255631 CCTCACCTGTGAGATGGGGTCGG - Intronic
901241598 1:7697334-7697356 CCTCGTCAATAGAATGGGGATGG - Intronic
901351772 1:8603627-8603649 CCTAATTTGTGTATTGGGGAAGG + Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
901895224 1:12306225-12306247 CTTCATCTGTGAAATCGGGGCGG - Intronic
902173063 1:14628705-14628727 CCTCATCTCTGAAACAGGGACGG - Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902617284 1:17630691-17630713 CCTCACCTGGGCAATGGGGATGG + Intronic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
902685925 1:18077632-18077654 CTTCATCGCTAGAATGGGGATGG + Intergenic
902689452 1:18101123-18101145 CCTCATCTGTAAAATGGGACTGG - Intergenic
902699390 1:18161307-18161329 GCTCCTCTGCGGCATGGGGATGG - Intronic
902704913 1:18197969-18197991 CTTCATCTGTGTAGAGGGGATGG + Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902814970 1:18911186-18911208 CCTAATCTGTCAAATGGGGGTGG - Intronic
902936906 1:19771027-19771049 CCTCAACTATGAAATGGGGATGG + Intronic
903029718 1:20454993-20455015 CCTCCCCTGTGGAATGGGAATGG + Intergenic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903174535 1:21573082-21573104 CCTCATCTGTGAAACGGGCATGG + Intronic
903177501 1:21589817-21589839 CCCCATCTGTACAATGGGCAGGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903320225 1:22538721-22538743 CATCTTCTGTGAAATGGGGAGGG + Intergenic
903353386 1:22731473-22731495 CCTTATCTGTCAAATGGAGAGGG + Intronic
903463260 1:23533984-23534006 CCTCATCTTTGAAATGGAGGCGG + Intergenic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903536400 1:24069398-24069420 CTCCATCTGTGCAATGGGGCTGG - Intronic
903619601 1:24688349-24688371 CCTCTTCTGTTAAATGGGCATGG + Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903812413 1:26042091-26042113 CCCCATCTGTCAAATGGGGACGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903849988 1:26300290-26300312 CCTCCTCTGTGAAGTGGGCATGG - Intronic
903857795 1:26346844-26346866 TCTCATCTGTGAAATGGGCATGG + Intronic
903882646 1:26522053-26522075 CCTCATCTGAGGAATGGGAATGG - Intergenic
903898083 1:26621627-26621649 CCCCATCTCTAAAATGGGGAAGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904318934 1:29684035-29684057 CCCCATCTATAAAATGGGGATGG + Intergenic
904424314 1:30413813-30413835 CCTCATCTGTGGGATGAGGGTGG - Intergenic
904449942 1:30604744-30604766 CTTCATCTGTCAAATAGGGATGG - Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904495964 1:30886860-30886882 GCCCATCTGTGAAATGGGAATGG - Intronic
904611084 1:31726742-31726764 TCACATCTGTGAAATGGGGATGG - Intergenic
904642863 1:31943804-31943826 CCTCATCTGTAATATGGGCATGG + Intronic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905447586 1:38037091-38037113 CCTCACCTGTAGGCTGGGGATGG + Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905861767 1:41356882-41356904 CCTCATCTGGGAAATGGGAATGG - Intergenic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906450873 1:45946322-45946344 CCTCATCTTGAGACTGGGGATGG + Intronic
906591361 1:47027261-47027283 CCTGATCTGATAAATGGGGAGGG - Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907046435 1:51302860-51302882 TCTCATCTGTGAAATGGGGGTGG - Intronic
907133146 1:52114920-52114942 CCTCATCTGTGAAACAGGAATGG + Intergenic
907331464 1:53674490-53674512 CCACATGTGTAAAATGGGGACGG + Intronic
907715857 1:56925405-56925427 CCTCATCTGTGAGATGGGGATGG - Intergenic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907798077 1:57737457-57737479 CCTCATCTGTTAAATGGTGGTGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908570794 1:65408019-65408041 CCTCATCCATAAAATGGGGATGG - Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909695943 1:78467802-78467824 CCTCATCTGTGCAAGGGTGCTGG + Intronic
909761473 1:79293035-79293057 CCTAACCTGTTGAATGGTGATGG - Intergenic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910749385 1:90612178-90612200 CCTCATCTGTGAAATGGGCTAGG - Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912354979 1:109047594-109047616 CTTCATCTGTGGGATGCTGAAGG + Intergenic
912363963 1:109117594-109117616 CCTGATCTGTGAAATGGGGATGG + Intronic
912556555 1:110520423-110520445 CCTCAGTTGTGGAATGAGGAAGG + Intergenic
912598602 1:110904036-110904058 CCTCTCCTTTGGAAAGGGGAGGG + Intergenic
912692359 1:111813807-111813829 CCTCATCTATATAATGGGAAAGG - Intronic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
914394303 1:147250453-147250475 CCACATCTGGGGATTGGGAAGGG + Intronic
914447151 1:147759744-147759766 CTTCATTTATCGAATGGGGATGG + Intronic
915312212 1:155010434-155010456 CGTCATATGGGGGATGGGGAAGG + Intronic
915364690 1:155308425-155308447 CCTCATCTGTTGAATGAGGGTGG - Intergenic
915922903 1:159990510-159990532 CCTCATATGGGGAAGGGAGAGGG - Intergenic
916196398 1:162227491-162227513 CCTCCTGTGTGGACTGGGGTTGG + Intronic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916514958 1:165507629-165507651 CCTCATCTCTGAAATGTAGAGGG + Intergenic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
917089261 1:171336539-171336561 CCTCATGTGTGGAAGGGGCCTGG - Intronic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
917904304 1:179574350-179574372 CCTCATCTGTGATAAGAGGATGG + Intronic
918073510 1:181151447-181151469 TCTTATCTGTGAAATGGGAATGG + Intergenic
918324110 1:183393322-183393344 CCTCATCTGTAAAATGGGATTGG - Intronic
919798284 1:201334815-201334837 CCTAAGCTGTGGAAAGGAGAAGG + Intergenic
919899630 1:202034524-202034546 CCTTATTTGGGGAATGGGGGTGG + Intergenic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
921212925 1:212915448-212915470 CCCCATCTGTGGAATGGAAATGG - Intergenic
921260959 1:213384689-213384711 CCTTGTCTGTAGAATGGAGATGG - Intergenic
921263017 1:213400532-213400554 CCTCATCTCTGGAAGGGGCAGGG - Intergenic
921303996 1:213777954-213777976 CCTCAGCTGTGGAATAAAGATGG - Intergenic
922350772 1:224733211-224733233 TCTCATCGGTGAAATGGGGATGG - Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
924165973 1:241283885-241283907 GCTCATCAGTGGAATGAAGAAGG - Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924242595 1:242055401-242055423 CCTCTTCCTTGGGATGGGGAAGG - Intergenic
924290280 1:242529456-242529478 CCTCATCTGTAACATAGGGATGG - Intergenic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1062843959 10:690334-690356 CCCCATCTGTGAAAAGGGGATGG + Intergenic
1063438039 10:6050331-6050353 CCTCATCCGTAAAATGGGAATGG + Intronic
1064220096 10:13432932-13432954 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1067456417 10:46422453-46422475 ACTGCTCTGTGGAGTGGGGAGGG - Intergenic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1067585772 10:47475159-47475181 CCTCATTTGTACAATGGGGGTGG + Intronic
1067630783 10:47962186-47962208 ACTGCTCTGTGGAGTGGGGAGGG + Intergenic
1068131595 10:52901943-52901965 GCACATCTTTGGAATGTGGAAGG + Intergenic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070653653 10:78255818-78255840 CCTTACCTGTGAAACGGGGATGG + Intergenic
1070684426 10:78470450-78470472 CCTCATCTGTGAAATGGGTGGGG - Intergenic
1070742217 10:78910656-78910678 CCTCCTCTGTGAGATGGGGATGG + Intergenic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1070958983 10:80485812-80485834 CCTCTTCTGTGGGTTGAGGATGG + Intronic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071549260 10:86553713-86553735 TCTCATCTGAAGACTGGGGATGG + Intergenic
1071782478 10:88861736-88861758 TCTCATCTGTTAAAAGGGGATGG - Intergenic
1071984822 10:91039716-91039738 TCTCATCAGAGCAATGGGGAAGG + Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072686443 10:97540040-97540062 CCTTCTCTGAGGAAGGGGGAGGG + Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073105571 10:101030626-101030648 CCTCTACTGAGGACTGGGGACGG - Intronic
1073118039 10:101103442-101103464 CCTCATCTGTGACATGGGGATGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073471681 10:103726380-103726402 CCTCACCCGTAGTATGGGGATGG - Intronic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074446402 10:113524688-113524710 ACCCATCTGTACAATGGGGATGG - Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074839696 10:117337781-117337803 ACACATCTGTGAAATGGGCAAGG - Intronic
1074889927 10:117727155-117727177 CCTCATCTATAAAATGGGGCAGG + Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1074944284 10:118266149-118266171 CCTCATCTGTAAAATGGCAAAGG + Intergenic
1075406348 10:122198322-122198344 CCTTATCTGTGAAATGAAGAGGG + Intronic
1075444735 10:122505530-122505552 CCTCATCTGTTAAATGGGCATGG + Intronic
1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG + Intergenic
1075537992 10:123287330-123287352 CCTCCTCTGTGAAATGGAGCCGG + Intergenic
1075551275 10:123394505-123394527 CCTCATCTGGGGAACGAGGTTGG + Intergenic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1076161755 10:128249333-128249355 CTTCATCTGTTGAATGAAGAAGG + Intergenic
1076823933 10:132957916-132957938 CCTCATCTGAGGACTGAGGGAGG + Intergenic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078448712 11:11424462-11424484 CCTCATCTATGAAGTGGAGATGG + Intronic
1078527608 11:12112058-12112080 CCCCATCTCTAAAATGGGGAGGG - Intronic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1078727600 11:13945572-13945594 CCTCATCTATGAAATGGGGATGG + Intergenic
1078779126 11:14420577-14420599 CCTCATCTGTAGAACAAGGATGG + Intergenic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1078974550 11:16457538-16457560 CTTCATCTGTTAAATGGGTATGG - Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079051673 11:17166163-17166185 CCTCAACTGTAAAATAGGGATGG + Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1080682643 11:34490650-34490672 TCTCCTCTGTAGAATGGGGTGGG + Intronic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1080869400 11:36224260-36224282 CCTCGTCTGTGAAATGGTGGTGG - Intronic
1081195141 11:40152131-40152153 CCCCATCTGTGGAAGTAGGAAGG + Intronic
1081612732 11:44572756-44572778 CCTCATCTGTGAAATAGGGATGG + Intronic
1081617059 11:44597336-44597358 TCCCATCTGGGGATTGGGGAAGG + Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081960643 11:47134110-47134132 CCTCATCTGTGAAATGGGACTGG + Intronic
1082790770 11:57345487-57345509 TCTCATCTGTCGAATGGGAATGG + Intronic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083155082 11:60817761-60817783 CCTCTTCTGTGTAAAGGGGGTGG - Intergenic
1083190992 11:61052464-61052486 CCAAACCTGTGGAATGGGGTGGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083276166 11:61598219-61598241 CCTCATCTGTCAAATGGGGTGGG - Intergenic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1084089376 11:66870184-66870206 CCCCTTCTGGGGACTGGGGATGG - Intronic
1084146584 11:67268131-67268153 TCTCATCTGTGAAATGTGGATGG + Intronic
1084323931 11:68388322-68388344 CCTCATCTGTGAAAAAGGAAGGG + Intronic
1084404907 11:68966070-68966092 CCTCAGCTGTGACCTGGGGATGG + Intergenic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085426990 11:76413493-76413515 CCTCATCTATAAGATGGGGATGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085640160 11:78188441-78188463 TCCCATCTGTGAAATGGGGATGG - Intronic
1085740056 11:79070720-79070742 TCTCATCTGTCAGATGGGGATGG - Intronic
1085776662 11:79372674-79372696 CCTCTTCTGTGAAATGGGAGGGG + Intronic
1086012986 11:82127861-82127883 CCTCAGTAGTGGAATGGAGATGG - Intergenic
1086095433 11:83045674-83045696 CCTCAGCTGTAAAATGGGTATGG + Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1087151746 11:94866277-94866299 ACTCATCTGTGAAGTGGGGAGGG + Intronic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088500572 11:110478554-110478576 GCTCATCCGTGGAATGAGAACGG - Intergenic
1088717530 11:112561824-112561846 CATCAGCAGTGGAATGGGGAAGG - Intergenic
1088972669 11:114787360-114787382 CCTCCTCTGTGGCGTGGGGTGGG + Intergenic
1089064037 11:115648842-115648864 CCTCGTCTGTGAACTGAGGAGGG - Intergenic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089466820 11:118690900-118690922 CCTCATCTGGGGAAAGGGTTTGG + Intergenic
1089480666 11:118802360-118802382 TCTCATCTGTTTAATGGGGATGG + Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089775986 11:120836294-120836316 CCTCAGCTGTAAAATGGGGTTGG + Intronic
1090094609 11:123730449-123730471 CCTGATCTGTGTGATGTGGAGGG - Intronic
1090163261 11:124517806-124517828 CCTCATGTGTCGAATGGTGATGG - Intergenic
1090249119 11:125238938-125238960 CCTCATCTCTGGAATAGAAATGG + Intronic
1090487455 11:127126822-127126844 CCTCATCTGTAGTATAGGGCTGG + Intergenic
1090983501 11:131745336-131745358 CCTCATCTTTTAACTGGGGAGGG + Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091446534 12:546876-546898 CCCCATCTGTGAAACGAGGACGG - Intronic
1091585351 12:1812849-1812871 CCTCATCTGTGAAACGGGAACGG + Intronic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1091906771 12:4195443-4195465 CCACATCTGTGGAAAGGGAGGGG - Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092411611 12:8257451-8257473 CCTCATCTGTAACTTGGGGATGG + Intergenic
1092477036 12:8828340-8828362 ACTCCTCTGTGAAAAGGGGAAGG - Intronic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1096010799 12:48212738-48212760 ACTCAAGTGAGGAATGGGGAAGG + Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1097167229 12:57092354-57092376 CCTCATTTGTCCAATGGTGAAGG + Intronic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1097811393 12:64023058-64023080 CTTTATCAGTGAAATGGGGATGG + Intronic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100483003 12:94997311-94997333 CTTCATCTGTGAAATGGGGGCGG + Intronic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1101013277 12:100473212-100473234 CCTCATCTGTAGAATGGATATGG - Intergenic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101422754 12:104562958-104562980 CCCCATCTGTGAAATGGGTATGG + Intronic
1101827447 12:108231507-108231529 CCTCATCTGTAAAATGGGTTGGG - Intronic
1101841579 12:108331249-108331271 TCCCATCTGTGAAATGGGGATGG - Intronic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1101980847 12:109405790-109405812 GCTCAGGTGTGGAATTGGGACGG + Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102187911 12:110964327-110964349 CCACATCTGTAGAATGGAGATGG - Intergenic
1102412339 12:112730782-112730804 CTTCTTCAGTGGCATGGGGATGG - Intronic
1102428491 12:112863028-112863050 CCTCATTTGAGGGATGGGCAAGG + Intronic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102563348 12:113778587-113778609 CCTCATCTATGCAATGGGAATGG - Intergenic
1103042420 12:117706376-117706398 CTCCATCTGTGAAATGGGGTTGG - Intronic
1103123532 12:118400716-118400738 CCTCTTGTCTGGGATGGGGACGG - Exonic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103370710 12:120417023-120417045 CCATATCTGTGAAATGGGCAGGG + Intergenic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1103632439 12:122272964-122272986 CATGGTGTGTGGAATGGGGAGGG + Exonic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104697687 12:130876040-130876062 CTTCATCTGTGGGATGCTGAAGG + Exonic
1104861983 12:131928855-131928877 CAGCGTCTGTGGAACGGGGACGG + Intergenic
1105471621 13:20700352-20700374 TCTCATCTGTGGTCTGTGGAAGG + Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106296923 13:28422890-28422912 CCTTCTCTGTGGAATGGAAAGGG - Intronic
1106883194 13:34153990-34154012 GCTCATGTGTGTAATGAGGAAGG - Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1108140481 13:47415982-47416004 CCCCACCTGTGAAAGGGGGAGGG - Intergenic
1108962104 13:56247216-56247238 CTTTATCTGTGGAAAGGGGAGGG - Intergenic
1108983618 13:56553894-56553916 CCTCACCTGTAGATTGGGTAAGG + Intergenic
1109639322 13:65167184-65167206 CATCATCTGTGAAACGGGGGTGG + Intergenic
1109778374 13:67074298-67074320 CCTCATCTGGGGAAGGGGCGAGG - Intronic
1110167436 13:72460324-72460346 CTTGGTCTGTAGAATGGGGAGGG + Intergenic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1111649893 13:91076247-91076269 CCTTCTCTGTGAAATGTGGAAGG + Intergenic
1111897161 13:94155967-94155989 CCTCATCCTTCGAATGGAGATGG - Intronic
1111944553 13:94650560-94650582 CCACATTTGTGGAATGGTGTTGG + Intergenic
1111983902 13:95046081-95046103 CCTCTTCTTTGTAATGGAGAGGG - Intronic
1112329605 13:98467060-98467082 TCTCATCTGTAGAATGGAGGTGG + Intronic
1112356709 13:98679529-98679551 TCTCCTCTGTGGAATGGGAATGG + Intergenic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1113907675 13:113827521-113827543 CCTTATCTGTGAAACGAGGAGGG + Intronic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114417058 14:22551920-22551942 CATCATCTGTGGGATGGCGGAGG - Intergenic
1114634163 14:24178074-24178096 CCTCCTCTGTTGAGTGGGGAGGG - Exonic
1114774461 14:25465511-25465533 CCACAGCAGTGGAAAGGGGAAGG + Intergenic
1115091385 14:29580961-29580983 TGTCATCTGTGGTCTGGGGAGGG - Intronic
1115497757 14:34023875-34023897 CCTCATCTGTGAAATAGGGTAGG - Intronic
1115513502 14:34161492-34161514 ACTCATCTATAAAATGGGGATGG + Intronic
1115773340 14:36688686-36688708 CCTCTTCTGTGAGCTGGGGAAGG - Intronic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118160731 14:63287332-63287354 CCTGAGCTGTGAAATGAGGATGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118898348 14:69965655-69965677 CATCAGCTGTGCCATGGGGATGG + Intronic
1119643736 14:76333978-76334000 CCCCATCTGTAAAATGGGGCAGG + Intronic
1119684524 14:76620792-76620814 CCCCATCTTTGAAATGGGGAGGG + Intergenic
1119726585 14:76925118-76925140 CCCCACCTGTGAAATGGGGTCGG + Intergenic
1119892041 14:78190135-78190157 CCTCAATTGTGGAAGAGGGAAGG - Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120679848 14:87467646-87467668 CTTCATCTGTGAAATAGGAATGG + Intergenic
1120732680 14:88021079-88021101 CCTCTGCTGTGGGATAGGGAAGG + Intergenic
1120780324 14:88480524-88480546 CCTCATCTATAGGATGGGCATGG + Intronic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1121259685 14:92557242-92557264 CCTCATCTATACAATGGGCAAGG - Intronic
1121265960 14:92602857-92602879 CCCCATCTGTGCCATGGGGAGGG + Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121562671 14:94886592-94886614 CCTCATCTGTGAAATGGAGGTGG + Intergenic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121907560 14:97760965-97760987 TCTCTTCTGGGAAATGGGGATGG + Intronic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122138518 14:99648328-99648350 CCTCATCTGTGGAAGGGGAAAGG - Intronic
1122146654 14:99693018-99693040 CCTCATCTGTGAAATAGAGTTGG + Intronic
1122149256 14:99715970-99715992 CCCCCTCTGCGGACTGGGGAGGG + Intronic
1122151930 14:99730330-99730352 CCCCATCTGTGAAATGGGGGTGG - Intergenic
1122167571 14:99840452-99840474 CTTCATCTGTGGCATGAGGGTGG + Intronic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1122314684 14:100818686-100818708 CCACATCTGTGGGAAGGGAAGGG + Intergenic
1122546877 14:102527950-102527972 CCTGCCCTGTGGGATGGGGAGGG + Intergenic
1122636837 14:103133976-103133998 CCTCCTCTGTGAAACGGGAATGG - Intronic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124517508 15:30379510-30379532 CCTCATCTGTAAAATTGCGATGG - Intronic
1124541142 15:30586745-30586767 CCTCATCTGTAAAATTGCGATGG + Intergenic
1124597253 15:31101660-31101682 CCACAGCAGTGGAATGGAGAGGG + Intronic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1125084213 15:35711718-35711740 CTTCATCTCTGGAATGGAGATGG + Intergenic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126414890 15:48407150-48407172 CTTCATTTATGAAATGGGGATGG + Intergenic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127559075 15:60118073-60118095 CGGCATTTGTGGACTGGGGAAGG + Intergenic
1127634654 15:60857869-60857891 TCTCATCTGTGAAATGGAGGTGG - Intronic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1128185234 15:65639131-65639153 CCCCATCTATGGAAAGGGAAAGG - Intronic
1128258868 15:66217878-66217900 CCTCAGCTGAGTAATGGAGAAGG + Intronic
1128346007 15:66852779-66852801 CCCCTTCTGTGAAATGGGGACGG - Intergenic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1128904695 15:71456522-71456544 TCCCATCTGTGAAATGGGGATGG - Intronic
1128979179 15:72174462-72174484 CCACAGCTGGGGCATGGGGATGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129252257 15:74315473-74315495 CCTCCTCTGTGGAATGGACATGG + Intronic
1129328680 15:74815748-74815770 CGTCATCTGAGAAATGGGAAGGG + Intronic
1129518023 15:76168743-76168765 CCTCCACTGGGGGATGGGGAGGG + Intronic
1129687121 15:77692858-77692880 CTCCACCTGTGGAATGGGGCTGG - Intronic
1129692878 15:77723754-77723776 CTTCACCTGTGACATGGGGATGG + Intronic
1129750134 15:78056890-78056912 GCTCACCTGTGGCATGGGGATGG - Intronic
1129835459 15:78702717-78702739 CTCCTCCTGTGGAATGGGGAAGG - Intronic
1130206484 15:81880313-81880335 ACTCATCTGTGGATTGGTGGAGG + Intergenic
1130393475 15:83480405-83480427 TCTCATCTGTGAAATTGGGATGG - Intronic
1130519018 15:84648089-84648111 CCTTATCTGTGAAATGAGGGTGG - Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131404455 15:92152871-92152893 CCTCATCTGTGGAGTTGCTATGG + Intronic
1131424806 15:92336996-92337018 ACTCATCTGTGGAAGGGCCACGG - Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132373560 15:101313691-101313713 CCCCGTCTGTGAAATGGTGATGG - Intronic
1132803711 16:1766254-1766276 CCTCCTCTGTGGACTGGGACGGG - Exonic
1132816366 16:1829383-1829405 CTTCATCTGAGTAATGGGGATGG - Intronic
1132895431 16:2226959-2226981 CCTCATCTGTAAAATGGGCTGGG - Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133598743 16:7318526-7318548 TCTCATCTGTGAGATGGGGATGG + Intronic
1133683234 16:8140644-8140666 TCTCATCTGTCAAATGGGTAGGG + Intergenic
1133862598 16:9610199-9610221 CCTCATCTGTTAAATGGAGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921751 16:10159622-10159644 CCTCATCTGTAAAATGGGATTGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG + Intergenic
1134781032 16:16895718-16895740 TCTCATCTGTGGAATGGCGGCGG - Intergenic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1134838586 16:17382854-17382876 CCTCACCTGGGTAATGGGGATGG - Intronic
1134875048 16:17690720-17690742 TCTCAGCTGTGAAATGGGGGCGG - Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135160156 16:20087199-20087221 CCTCATCTGTAACATGGAGAAGG - Intergenic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135458732 16:22622625-22622647 CCTCATCTGTAAAATGGCAAAGG - Intergenic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136067612 16:27769453-27769475 CCTCATCTGTTAAATGGGCACGG - Intronic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136112043 16:28069737-28069759 CCTCGTCTGTGAAATGAGGGCGG + Intergenic
1136180138 16:28546132-28546154 CCTCTTCTGTTAAATGGGGTCGG - Intergenic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1136928256 16:34395343-34395365 TCTCACCTGTGAAGTGGGGATGG - Intergenic
1136976318 16:35016461-35016483 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137706326 16:50538378-50538400 CCTCATCTGTGAAGTGGAGATGG + Intergenic
1137715842 16:50597908-50597930 CCTCATCTGGTGGTTGGGGATGG + Intronic
1138008326 16:53357160-53357182 CCTCAGCTGAGAAATGGGGTGGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138131681 16:54485154-54485176 CCTCGTCTGTAGAATGGATATGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138414821 16:56865599-56865621 TGTCATCTGTGCCATGGGGATGG + Intronic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138576379 16:57909897-57909919 CCTCAGCTGTAAAATGGGAATGG + Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1139166587 16:64573176-64573198 CCTCAGATTTGAAATGGGGATGG - Intergenic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139568716 16:67796957-67796979 ACTCATCAGTGGAAGAGGGATGG - Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140016501 16:71192043-71192065 CCTTATCTGTGATATGGGAAGGG - Intronic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141632159 16:85294007-85294029 CGCCCTCTGTGCAATGGGGATGG + Intergenic
1141760838 16:86027441-86027463 GCTCATCTGTAGTACGGGGAGGG - Intergenic
1141808279 16:86356620-86356642 ACCCATCTCTGAAATGGGGATGG + Intergenic
1141824421 16:86468856-86468878 CCTCAGCTGGGGAATGGGGATGG + Intergenic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142031755 16:87842006-87842028 CCTCCTCTGTGAAATGGGCCTGG + Intronic
1142201031 16:88761263-88761285 GCTCATCTGTGAAATGGGCGTGG - Intronic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1142236096 16:88923278-88923300 CCTCCTCTGTGCGATGAGGAGGG - Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142593590 17:1018869-1018891 CCTCATCTGTGAGATGGGAGCGG - Intronic
1142895187 17:2971664-2971686 CCTCATCTGTGAAATGATGATGG + Intronic
1143179041 17:4972986-4973008 CCACATCTGAGGAAGGGGGCGGG + Exonic
1143377456 17:6475209-6475231 CTTCATCTGTGGGCTGGGGCTGG - Intronic
1143385852 17:6530073-6530095 CCTCATCTGTAGAATGGCAAGGG - Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144074626 17:11705504-11705526 CCTCATCTGTGAAATGGAAGTGG + Intronic
1144119165 17:12133468-12133490 CCTTATCTGAGGAATGCAGAAGG - Intronic
1144162372 17:12572375-12572397 CCTCATCTGTGAGATGGGGCTGG - Intergenic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144743432 17:17597163-17597185 CCGTGTCTGTGGAATGGGGAGGG + Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144764913 17:17727413-17727435 CCCCATCTGTGAAATGGGCAGGG - Intronic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144769357 17:17750985-17751007 CCTCCTCTGTGGAAGGCGGAAGG - Intronic
1144952073 17:18999845-18999867 CCTCAACTGTGAAATAAGGAAGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145142403 17:20456157-20456179 CGTCATCTGTAGAATGAGCATGG - Intronic
1145823345 17:27857542-27857564 CCTCATCAGTAGAATGGGGGTGG - Intronic
1145868166 17:28253829-28253851 CCTCATCTGTGAAATGGAGCTGG + Intergenic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146134528 17:30307282-30307304 CCTCATCTATAAAATGGGAATGG - Intergenic
1146380265 17:32322714-32322736 TCTCACCTGTGTAATGGGGTGGG - Exonic
1146431356 17:32798469-32798491 CCTTAACTGTGGACAGGGGAAGG - Intronic
1146457833 17:33020959-33020981 CCCCATCTATGCAATGAGGACGG - Intronic
1146579708 17:34025982-34026004 TCTCATCTGTGAAATGGGTATGG + Intronic
1146626990 17:34442480-34442502 CCTCCTCAGTGAAATGGGGATGG - Intergenic
1146637649 17:34518189-34518211 CTGCATCTGTTAAATGGGGATGG + Intergenic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1146932907 17:36790863-36790885 TCTCATCTGTGAAATGGACACGG - Intergenic
1146935827 17:36812168-36812190 CCTCATCTGTGAAATGGTGATGG - Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147021349 17:37536406-37536428 CCTCATCTGTGAAGTTGGGATGG + Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147128736 17:38392936-38392958 CTTTATATGTGAAATGGGGATGG + Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147769758 17:42859458-42859480 CCTCATCTGGGGCCTGGGGCAGG - Intergenic
1147923940 17:43935375-43935397 CCTCATCTGTGAAATGGAGCTGG - Intergenic
1148252602 17:46097500-46097522 CATTATCTCTGGAAAGGGGATGG + Intronic
1148317262 17:46712985-46713007 CCTGTTCAGTGTAATGGGGATGG + Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148588060 17:48794942-48794964 CCTCATCTGTAAGATGGAGATGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148871550 17:50661399-50661421 TCTCATCTGTGACATGGGAATGG - Intronic
1148954974 17:51346032-51346054 TCTCATCTGTGAAATGAGCATGG + Intergenic
1148986659 17:51628434-51628456 CCTCCTCTGCGAAATGGGGGAGG - Intergenic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1149610592 17:57955531-57955553 CCTCCTCTCTGGAAAGGGGTCGG - Intergenic
1150131874 17:62673913-62673935 TCCCAGCTGTGCAATGGGGAAGG - Intronic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1150802551 17:68292908-68292930 CCAGATCTGTAAAATGGGGATGG + Intronic
1151320128 17:73347987-73348009 CCCCATCTGTGGAACAGGCAGGG - Intronic
1151340417 17:73467393-73467415 CCTCATCTGTAACATGGAGATGG + Intronic
1151352772 17:73541496-73541518 CCTTGTCTGTGAAATGGGGGTGG - Intronic
1151364211 17:73606559-73606581 CCTCATCTGTGGAGTAGAAACGG - Intronic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1151796881 17:76352792-76352814 CCTCATCTGTGAAATGGGCATGG - Intronic
1151943161 17:77305314-77305336 CCTCCTCTATGAAATGGGGCGGG + Intronic
1152095702 17:78270411-78270433 CCTGATTTCTGGTATGGGGAGGG + Intergenic
1152169863 17:78738272-78738294 CCTCATCTGTGATCTGGGGATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152409714 17:80117289-80117311 GCTCATCTGGGAAATGGGGATGG - Intergenic
1152531360 17:80921323-80921345 CCTCATCTGTGTCAGGAGGATGG - Intronic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1153185190 18:2478395-2478417 GCTCATCAGTGGACTGGGCATGG - Intergenic
1153256767 18:3179508-3179530 CCTCAGATGTGAAATGGAGAGGG + Intronic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153646995 18:7204408-7204430 CCTCATGTGTGCAGTGGAGATGG - Intergenic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154103032 18:11494043-11494065 CCCTATCTGTGGAATGAAGAAGG + Intergenic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1154486689 18:14877618-14877640 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1154999832 18:21675240-21675262 CCTCATCTGTGGAATGAGGTGGG + Intronic
1155210648 18:23597821-23597843 CCTCAACTGTAAGATGGGGATGG + Intergenic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155876782 18:31099789-31099811 GCTGATTTGTGGAATGGTGAAGG + Intronic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156197534 18:34791868-34791890 CTTCATCTATGAAATGGGGCTGG - Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157156180 18:45268712-45268734 TTTCATCTGTTGAATGGAGAAGG + Intronic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157198834 18:45642003-45642025 CCTCATCTGTAAAATGGGCCAGG - Intronic
1157307082 18:46525199-46525221 CCTCCTCTGTGTAAGGGGGCTGG + Intronic
1157329301 18:46691893-46691915 CCTCAGCTGTGTACTGGAGATGG + Intronic
1157396701 18:47347496-47347518 CCTCATCTTTATAATGGGAAGGG - Intergenic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157562213 18:48656365-48656387 CCCCATCAGTAAAATGGGGATGG + Intronic
1158657729 18:59355347-59355369 GCTGATCTGTGGAATGGTGTTGG - Exonic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159541186 18:69778910-69778932 CCTAATGAGTGGAATGGGGATGG + Intronic
1160044185 18:75371492-75371514 CCTCATCTGTGGGATGGGAATGG + Intergenic
1160159462 18:76460259-76460281 CCTCGTCTGTGAAATGAGGGTGG - Intronic
1160428010 18:78791589-78791611 CCTCACTTGTGGAATGGGAGTGG - Intergenic
1160464341 18:79063570-79063592 CCTCATCTGGGGAAAGGTGAAGG + Intergenic
1160557995 18:79738437-79738459 CCTCACCTGTGAAATGAGGTAGG + Intronic
1160565737 18:79785758-79785780 CCTCACCTGTGCAATGAGAAGGG + Intergenic
1160838754 19:1136977-1136999 CAGCACCTGGGGAATGGGGATGG + Intronic
1160939936 19:1615510-1615532 CCTCGTCTGGGCTATGGGGAGGG + Exonic
1161084392 19:2327928-2327950 CCTCATTTGTCAAATGGGGCTGG - Intronic
1161476412 19:4488378-4488400 CCACTTCTGGGCAATGGGGATGG - Intronic
1161505575 19:4641597-4641619 CCCCATCTGTCCAATGGGGCTGG + Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161631843 19:5360925-5360947 CCCCATCTGTAAAATGGGGCTGG - Intergenic
1161772813 19:6240489-6240511 CCTCACCTGTGAAGTGGGAAAGG + Intronic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1162180148 19:8863122-8863144 GCCCATCTGTGAAATGGGAATGG + Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1162733363 19:12732160-12732182 CCTCATCTATGAAAAGGGGGTGG - Intronic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1163708999 19:18834110-18834132 CCGCAGCTGTGAAATGGGGGTGG + Intronic
1163848604 19:19651147-19651169 CCTCCTCTGTGGTGTGGGGAAGG + Intronic
1164809131 19:31142191-31142213 CCTCATCTTTGGAAAGGAGGCGG - Intergenic
1165179619 19:33956570-33956592 GCACATCTGTGGATTGGGTATGG - Intergenic
1165229985 19:34380910-34380932 CCTCCTATGTGGAATAGGTAAGG + Intronic
1165313933 19:35043507-35043529 TCTCATCTGTGAAATGGAGAGGG + Intronic
1165362151 19:35343471-35343493 CCTCGTCTGTGTCATGAGGAAGG - Intronic
1165808667 19:38597132-38597154 CCTCCGCTGTGGCATGGGCAAGG + Exonic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166195383 19:41202433-41202455 CCTCACCTAGGAAATGGGGATGG + Intronic
1166765194 19:45248740-45248762 CCACATCTGGGAAATGGGGTGGG + Intronic
1166891874 19:45999051-45999073 CATCCTCTGTATAATGGGGATGG + Intronic
1167006891 19:46782159-46782181 CCTCATCTATAAAATGGGAACGG - Intronic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167271383 19:48508469-48508491 CCTAGTCTGTGGCCTGGGGAAGG + Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167659828 19:50790176-50790198 CCCCATCGGTACAATGGGGATGG + Intergenic
1168243390 19:55098242-55098264 CCTTATCTGTCAAATGGGAATGG - Intronic
1168246119 19:55113939-55113961 CCTCCTGGGTTGAATGGGGAGGG - Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168397390 19:56060248-56060270 CCCCATCTGTGAAATGGGGGCGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
925097794 2:1220992-1221014 GCACATCTGTTGGATGGGGAGGG - Intronic
925189861 2:1874289-1874311 CCCCATCTGTGAAATGGGCACGG + Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925967060 2:9075903-9075925 CTTCCTCTCTGGTATGGGGAAGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
926388203 2:12359651-12359673 CCTGATTTGAGGAATGGGAAGGG + Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
926920650 2:17936837-17936859 CCTCATCTATAAAATGGGAATGG - Intronic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927088664 2:19694095-19694117 CCTCATCTATAAAATGGGCAGGG + Intergenic
928101371 2:28439501-28439523 CCTGGCCTGTGGGATGGGGAAGG - Intergenic
928200399 2:29244279-29244301 CCTCATTTGTGAAATCAGGATGG + Intronic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
928399989 2:30970881-30970903 GCTCATCTGTGGAGTGGGGGCGG - Intronic
928447749 2:31348077-31348099 CCTCATCTGTGCAAAGGAGTTGG - Intronic
929284194 2:40116988-40117010 CCTAATCTGTTAAATGGGGATGG + Intronic
929449593 2:42027903-42027925 CTGCATCTGTGGAATCGGGAGGG - Intergenic
929538857 2:42804220-42804242 CCTCTGCTGAGGAATGGGGAGGG - Intergenic
930884907 2:56314391-56314413 CCTCATCTGTGGAATGAGAAGGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931821256 2:65954656-65954678 TCACATCTGTGGTGTGGGGAGGG - Intergenic
931989099 2:67771639-67771661 CCTCATCTGTCAAATGGAGATGG - Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
932305866 2:70703998-70704020 CCTCATCTGTGGAGTCAGGTTGG + Intronic
932748998 2:74359146-74359168 TGTCAGCTGAGGAATGGGGATGG + Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933536260 2:83578649-83578671 CCACATCTGAAGAATGGGCAAGG + Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937204152 2:120224894-120224916 CTTCATCTGTGAAATGGGCTTGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
937343285 2:121105518-121105540 TCTCATCTGGGAAATGGGGATGG - Intergenic
937365752 2:121260139-121260161 CTTCATCTCTGAAATGGGCACGG - Intronic
937848953 2:126615680-126615702 CTTCATCTTTGCAATGGAGATGG + Intergenic
937969229 2:127536562-127536584 CGTCCTCTGTGAAATGGGGATGG - Intronic
938377947 2:130820724-130820746 CCTCCTCTGCGGCACGGGGAAGG + Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
938672331 2:133598133-133598155 CCTCATCCCTGTAATGAGGATGG + Intergenic
940880737 2:158944239-158944261 AATCAGCTGTGGAATAGGGAAGG - Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
942202354 2:173583949-173583971 CCTCATCTGTGGAATGGTAGTGG - Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
943915534 2:193627584-193627606 CCTCTGCTGTGGGGTGGGGAAGG - Intergenic
944436023 2:199690564-199690586 CCACCTCTGAGGAATGGGGCAGG - Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944617039 2:201471532-201471554 CCTCATCTGCGAAATGGGAGTGG - Intronic
944988996 2:205212947-205212969 CCCCATCTGTAAAATGGCGATGG - Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945058389 2:205887878-205887900 CCTGATCTGTGGAATGGGGGTGG - Intergenic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946275499 2:218628636-218628658 CCCCATCTGTGAAACAGGGATGG + Intronic
946302221 2:218830894-218830916 GCTCATCTCTGGAAGGGGAATGG + Exonic
946787263 2:223260797-223260819 GCTCATCTGAGGAATGTGCAGGG - Intergenic
946807884 2:223490017-223490039 CCTCATCTGAGAAATAGGGATGG + Intergenic
947179740 2:227401446-227401468 CCTAGTGTGTGGGATGGGGAAGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948503086 2:238408977-238408999 CCTCATCTGTGGGTTGGCTATGG - Intergenic
948631983 2:239308154-239308176 CCTCATCTGTGAGATGGGGGTGG + Intronic
948794928 2:240397628-240397650 CCTCGTCTGTAGAAAGGGGTTGG - Intergenic
948907520 2:240986851-240986873 CCCCATCTGTGAAGTGGGGAAGG + Intronic
1168803029 20:655645-655667 CCCCATCTATCAAATGGGGATGG - Intronic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1168845681 20:942961-942983 CCTCATCCATGAAATGAGGATGG + Intergenic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1169537047 20:6556546-6556568 CCCCATCTGTGGAAAGGCTACGG + Intergenic
1169906576 20:10610547-10610569 CCTCAAGTCTGAAATGGGGAAGG + Intronic
1170009913 20:11711872-11711894 CCTCATCTGTGAAATCTGGGAGG - Intergenic
1170057726 20:12225222-12225244 CTTCATCTGTGAAATGAGTACGG + Intergenic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170509242 20:17059819-17059841 CCTCATCTTTCAAATGTGGATGG - Intergenic
1170635103 20:18097352-18097374 ACTCATCTGTGGCATGATGATGG - Intergenic
1170796606 20:19552873-19552895 CTTCATCAGAGGAAAGGGGAGGG + Intronic
1170907624 20:20530200-20530222 CCTCATCTGTGAAGTGGAGGTGG + Intronic
1171387800 20:24781851-24781873 CCTCACCTGTGTAATGAGGGTGG - Intergenic
1171490986 20:25516975-25516997 CCTCATCTGAATAATGGGTATGG + Intronic
1171977509 20:31604927-31604949 TCTCATCTGTGAAATGGAGCTGG + Intergenic
1172049848 20:32109168-32109190 TCCCATCTGTGAAATGGGAAGGG - Intergenic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1172973427 20:38889624-38889646 CCTGATTTGTGCAATGAGGACGG + Exonic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173605135 20:44326566-44326588 TCCCATCTGTTAAATGGGGATGG - Intergenic
1173656286 20:44702576-44702598 CCCCATCTATGAAATGGGAATGG - Intergenic
1173852985 20:46230487-46230509 CCTCAGCTGTGAAATGGGGATGG - Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1173912404 20:46680022-46680044 CCCCATCTGTAAAATGGGTATGG + Intronic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1174817015 20:53695969-53695991 CCTCATCTGTGGGATGAGAATGG - Intergenic
1175142305 20:56870089-56870111 CCTCACCCCTGCAATGGGGAAGG - Intergenic
1175183428 20:57164512-57164534 CTTCATCTGTGACATGGGTATGG - Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175550085 20:59811852-59811874 CCTTGTTTGTGAAATGGGGATGG + Intronic
1175679248 20:60973499-60973521 CCCCATCTGTGAAATGAGTATGG + Intergenic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1175919617 20:62444613-62444635 CCTCATCTGTGCAGCGGGGAAGG + Intergenic
1175951450 20:62585719-62585741 TCTCCTCTATGGAATAGGGACGG + Intergenic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1176230936 20:64032610-64032632 CCTCATCTGTGGGCTGAGGCTGG + Intronic
1176794613 21:13361781-13361803 TCTCATCTGTTCAGTGGGGATGG + Intergenic
1176795000 21:13365325-13365347 CCTCACCTGTAGAATAGGAATGG - Intergenic
1177647232 21:23914878-23914900 CCTCATTGGTAGAATGGAGATGG - Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1178087696 21:29128749-29128771 GCTCATCTGTCAAATCGGGATGG + Intronic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178860802 21:36287451-36287473 ACTCAGCTGTGGCAGGGGGACGG + Intronic
1179029244 21:37705368-37705390 CCTCATTTGTTAAATGGGAATGG + Intronic
1179051444 21:37891898-37891920 TCTCAAGTGTGGGATGGGGAAGG + Intronic
1179110148 21:38439159-38439181 CATCGCCTGTGGAAAGGGGAAGG + Intronic
1179426231 21:41280644-41280666 CCACATCTGCGGAATGTGGAAGG + Intronic
1179611479 21:42554694-42554716 CCTCATCTGTGACATAGGGGAGG - Intronic
1179988091 21:44932277-44932299 CCCCATCTCTATAATGGGGACGG - Intergenic
1180708204 22:17822541-17822563 CCTCAGCTGTGGAGTTGGGGTGG - Intronic
1180727118 22:17954459-17954481 CATCACCTGGGGCATGGGGAGGG + Intronic
1180952799 22:19728348-19728370 CCGCTGCTGTGGGATGGGGAGGG - Intergenic
1181055298 22:20258089-20258111 TCTCCTCTGTGGGGTGGGGATGG - Intronic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181728303 22:24826894-24826916 CCTCATCTGTGTAACGGGGATGG - Intronic
1181802777 22:25358261-25358283 CCTCATCTGTGAAAGAGGAAGGG - Intronic
1181923657 22:26340589-26340611 CCTCATCTTTGGAAAGGGCCAGG + Exonic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182047309 22:27285413-27285435 CCTCATCTATAAAATGGGAAGGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182117013 22:27762321-27762343 CCTCATCTATGAAATGGGGATGG + Intronic
1182137783 22:27921733-27921755 CATCATCTGGGGAATGGTGGAGG + Intergenic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182318754 22:29464777-29464799 TCTCATCTGTGAAATGGGTGGGG - Intergenic
1182461286 22:30485735-30485757 CCTCATCTGTAGGCTGCGGATGG + Intergenic
1182517720 22:30868502-30868524 CCTCATCTATTGCCTGGGGATGG - Intronic
1182517897 22:30869331-30869353 CCTCATCTGTCACCTGGGGATGG + Intronic
1182586480 22:31346646-31346668 GCGGATCTGGGGAATGGGGAGGG - Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1183035577 22:35138666-35138688 GCTCACCTGTGAAATGGGGGTGG + Intergenic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183346497 22:37311187-37311209 CCCCATCTGTAAAATGGGCATGG - Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183425996 22:37739700-37739722 TCCCATCTGTGGAATGGGCGGGG + Intronic
1183477449 22:38043283-38043305 CCTCAGCTGAGGGATGGGGCTGG - Intergenic
1183603186 22:38851869-38851891 CCCCATCTATGAAATGGGAAAGG - Intergenic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1183666939 22:39251579-39251601 CCCCATTTGTGAAATGGGGGTGG - Intergenic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184040642 22:41941183-41941205 CCTCATCAATGGAACGGGGCCGG + Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184160567 22:42694943-42694965 CCTCATCTGTAGGGTGGGGGTGG - Exonic
1184642249 22:45878922-45878944 TCTCATCTGTGGAATGGGCCGGG + Intergenic
1184697079 22:46145776-46145798 CCTCATCTCTAAAATGGGGCAGG - Intergenic
1184747736 22:46465799-46465821 CCTCACCTGTGAACTGGGGGTGG - Intronic
1184768631 22:46585720-46585742 CCTGGTCTATGGGATGGGGAAGG + Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1185224855 22:49646637-49646659 CCTCATCTGTGCACACGGGACGG - Intronic
1185418911 22:50724369-50724391 TCTCAGATGTGGGATGGGGAAGG + Intergenic
949247846 3:1946449-1946471 TCTCATCTGTGGAGTGAGAATGG + Intergenic
949426779 3:3926138-3926160 ACACATCTATAGAATGGGGAAGG - Intronic
949497330 3:4644844-4644866 CCTTATCTCTGAAATGGGGGCGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949920444 3:8996105-8996127 CCTCATCTGTTAAATGGAAATGG + Intronic
949934132 3:9103460-9103482 CCTCATTTGTGAAATGGTGATGG - Intronic
950106629 3:10392810-10392832 TGTCATCTGTAGAGTGGGGAGGG + Intronic
950107404 3:10396933-10396955 CCTCACCCAAGGAATGGGGAAGG + Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950189606 3:10967416-10967438 CCTCATCTGTGAAATGCAGACGG - Intergenic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950474044 3:13204554-13204576 CCCCATCTCTGCAATGGGGACGG + Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950542086 3:13618770-13618792 CCTCTCCTGTGAAATGGGGTGGG + Intronic
950561010 3:13724591-13724613 ACTCTTCTGGGCAATGGGGAAGG - Intergenic
950653844 3:14424517-14424539 CCTGCTCTGGGCAATGGGGAGGG + Intronic
950654971 3:14430919-14430941 CCTCATCTGTAAAATGGGCTTGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950670559 3:14522900-14522922 CTTCATCTGGGGAAGGGGCATGG + Intronic
950704705 3:14772679-14772701 CCTCACCTGTGCAAGGGAGAGGG + Intronic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951308745 3:21098557-21098579 GCTCATCTGTGGAATGGGAATGG - Intergenic
951698707 3:25472558-25472580 CCTCATCTGTGAAATGGAGGGGG - Intronic
951935075 3:28014164-28014186 CCTCGTCTGTGAAATGTGGGAGG - Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
952966055 3:38621975-38621997 TCTCATCTGTGCAATGGGGAAGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953093143 3:39749540-39749562 CATCAGCTGAGGACTGGGGAGGG - Intergenic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953241818 3:41156128-41156150 CCTGCTTTGTGGAATGTGGATGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953471472 3:43170281-43170303 CCTCATCAGTGAATCGGGGATGG - Intergenic
954124381 3:48520146-48520168 CCTCATCTGTGGGGCAGGGAAGG + Intronic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
955071129 3:55573261-55573283 CCTCATCAGTAAAATGGGTATGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955530729 3:59870284-59870306 CCTCACCTGTGACATGGGAATGG - Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956699067 3:71942787-71942809 TCTCATGTGTGAAATGTGGATGG + Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956882597 3:73526371-73526393 CCTTATCTGTGGAATGGGTATGG - Intronic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
958440359 3:94148890-94148912 ACTCTTTTGTGGAATGGAGATGG + Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959905182 3:111703332-111703354 CCTCTTCTGTGGGATGGGCTGGG + Intronic
959917505 3:111832464-111832486 TTTCCTCTGGGGAATGGGGATGG - Intronic
960059685 3:113308263-113308285 CTTCATCTATGGAAAGAGGAGGG + Exonic
960302905 3:116026171-116026193 CCTCAGCTATGCAATGGGGCAGG + Intronic
960574498 3:119216861-119216883 CCTCATCTGTAAAATGGCAATGG + Intronic
960923618 3:122774261-122774283 CCTGATTTGGGGTATGGGGAAGG + Intronic
961418954 3:126784490-126784512 CCCCAACTGTGGAATGTGGCTGG + Intronic
961485144 3:127210910-127210932 CCCCCTCTGTGGAATGGGGAGGG - Intergenic
961535496 3:127568137-127568159 CCTCATCTGTAAAATGGGATAGG + Intergenic
961638505 3:128349969-128349991 CCACCACTGTGGAAGGGGGATGG - Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
961963662 3:130879936-130879958 CCTCATCGCTGGAATGGGCTGGG + Intronic
962471088 3:135709971-135709993 CTTCATCTGTAGAATGGGTGTGG - Intergenic
962481561 3:135802696-135802718 CCTCATCTGAGGAATTTAGAAGG - Intergenic
962708957 3:138069780-138069802 CCTCTTCTGTGGCCTGGGCAAGG - Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963843276 3:150130012-150130034 CTACATCTGTAGAATGGAGATGG + Intergenic
964409152 3:156380134-156380156 CCTCAGCTGATGGATGGGGAGGG - Intronic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
965910629 3:173770729-173770751 CCTCATCTGTGAAATGAAAATGG + Intronic
965944831 3:174227357-174227379 CCTCATGTGTGAAATGGAAAAGG - Intronic
966053416 3:175650969-175650991 CCTCATCTTTGAAATGTGGATGG + Intronic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
967278109 3:187796081-187796103 CCTCATCTGTTGAATGATGAGGG - Intergenic
967886499 3:194337032-194337054 CCTGAGCTAAGGAATGGGGAAGG + Intergenic
967889268 3:194353562-194353584 TCTCGTCTGTGGAATGGGTGTGG + Intergenic
967911493 3:194546052-194546074 CATCCTCTGAGGAGTGGGGAGGG - Intergenic
968434861 4:579219-579241 CCTCATCTCTGTATTGGGGGTGG + Intergenic
968808910 4:2791486-2791508 CCCCATCTGTGAAATGGAGGGGG - Intergenic
968880563 4:3296713-3296735 CCTCTTCTCTGGGATGGGCAGGG + Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969351140 4:6598527-6598549 GCTCATCCGTGCAATGAGGAAGG + Intronic
969478234 4:7433234-7433256 TTTCATTTGTGAAATGGGGATGG + Exonic
969520618 4:7675825-7675847 CCCCATCTCTAAAATGGGGATGG - Intronic
969600541 4:8173645-8173667 CCTCATCTGTGCAAGGGCGATGG - Intergenic
969618276 4:8266148-8266170 CTTTATCTGTGCAATGGGCATGG + Intergenic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970265024 4:14273055-14273077 CCTCAACTGTGGAATGAGTGTGG - Intergenic
970453873 4:16202077-16202099 CATCATCTGTGGAAAGGACAGGG - Intronic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
971474477 4:27059148-27059170 CCTCACGTGTGAAATGGGGATGG + Intergenic
971565433 4:28133319-28133341 CCTTGACTGTGGAGTGGGGAAGG - Intergenic
972241455 4:37197836-37197858 CCTTATCTGTGCAGTGGGGTTGG - Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972689005 4:41378370-41378392 CTTAATCTGTGAAATGGTGAGGG + Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
974415097 4:61596019-61596041 CCACAGCCGGGGAATGGGGAGGG + Intronic
976147865 4:82060378-82060400 TCTCATCTGTGAAATGTGGCAGG - Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
977089630 4:92653974-92653996 CTTCATATGTGGAAAGAGGATGG + Intronic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
980233644 4:130075789-130075811 GCACATCTCTGGAATGTGGAAGG - Intergenic
981410003 4:144418502-144418524 CCTCATCTATGAAATGGGAAGGG - Intergenic
982097836 4:151939144-151939166 TCTCATCTGCGTAATGGGAAAGG - Intergenic
982685260 4:158481055-158481077 CCTCATCTCTGGAAAAAGGAAGG - Intronic
983950429 4:173633591-173633613 CTTCATCTGTGGGATGCTGAAGG - Intergenic
984653295 4:182291580-182291602 CCTCAGCTGTACCATGGGGAGGG - Intronic
985849658 5:2379261-2379283 CCTCACCTGTGAAGTGGGGCAGG + Intergenic
985892101 5:2724159-2724181 ACTTATGTGTGGGATGGGGAGGG - Intergenic
986143160 5:5050489-5050511 ACTTATCCGTGGAATGGGCAAGG + Intergenic
986180704 5:5390597-5390619 CCACATCTGTGGAATCAGGGCGG + Intergenic
986321496 5:6635523-6635545 CCCCACCTGTAGAATGGGCATGG + Intronic
986805512 5:11305211-11305233 CCTCATCTGTCAAACGGAGATGG - Intronic
987707430 5:21473940-21473962 CCACATCTGTGGAATCAGGGCGG - Intergenic
987807386 5:22786638-22786660 CTTCATTTGTGTAATGGGGAAGG + Intronic
989062275 5:37421080-37421102 CCTCACCTGTCGAAAGGGGATGG - Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990592947 5:57283944-57283966 CCTTATCTTTGGAAAGGGGAGGG + Intergenic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992947117 5:81821953-81821975 ACTCAGTTGTGGAAGGGGGATGG + Intergenic
993491456 5:88556473-88556495 CATCATCTGTGGTGTGGGGCTGG + Intergenic
993729959 5:91410673-91410695 GCACATCTTTGGAATGTGGAAGG + Intergenic
994022066 5:95038660-95038682 TTTCATCTGTGAAATGGGGGAGG - Intronic
994226239 5:97254363-97254385 CTTTATCTGTGGAAAAGGGAGGG + Intergenic
995123184 5:108556767-108556789 TCTCATCTGAGGGAAGGGGAGGG + Intergenic
995280647 5:110331758-110331780 CCTCACATGTGGAAGGGGAAGGG - Intronic
996237221 5:121146098-121146120 TATCATTTGAGGAATGGGGATGG + Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997384040 5:133458634-133458656 TCCCATCTGTGGACTGGGGATGG + Intronic
997531578 5:134584725-134584747 CCTCAACTGTGGAATCAGCATGG + Intergenic
997622764 5:135309636-135309658 CCTCATCTGTGAAATGTGAGAGG + Intronic
998130132 5:139647754-139647776 CCTCACCTGAGAAATGGGAACGG + Intronic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998498446 5:142611363-142611385 CCTCACCTGTGGAATGGGAATGG - Intronic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999271671 5:150300270-150300292 TATCATCTGTAGAATGGGGGTGG - Intronic
999343643 5:150795803-150795825 CCTTATCTTTCAAATGGGGATGG + Exonic
999437321 5:151573104-151573126 CCACATCTTTGAAATGGGGCTGG - Intergenic
999438140 5:151580353-151580375 CCCCATTTGTGAAATGGGGCTGG + Intergenic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999608969 5:153349087-153349109 TCTCATCTGTGGAATGGGATGGG - Intergenic
999710850 5:154317054-154317076 CCTTATCTATGGAATAGGGATGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001165816 5:169365890-169365912 TCTCATTTGAGAAATGGGGAGGG - Intergenic
1001227063 5:169953883-169953905 CCTCATCAGTAGAATAGGAATGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001529457 5:172452159-172452181 TTTCATCTGTGTAATGGGGATGG - Intronic
1001544837 5:172564632-172564654 CCTCATCTGTACAGCGGGGATGG - Intergenic
1001591426 5:172867920-172867942 ACTCATCAGTAAAATGGGGAGGG - Intronic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1001728764 5:173931494-173931516 CCTCATCTAAGGAATGGATAGGG - Intronic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001773200 5:174311161-174311183 CCTCATCTGTGGAATGGGCGTGG + Intergenic
1001874159 5:175184985-175185007 CATTATCTGTGAAATGGGGATGG - Intergenic
1001935030 5:175697572-175697594 CCCCAGCGGGGGAATGGGGAAGG - Intergenic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002074293 5:176698978-176699000 CCGCATCTGTGGGCTTGGGATGG - Intergenic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002257831 5:177971869-177971891 CCTCTTGTCTGGGATGGGGACGG - Intergenic
1002580791 5:180208648-180208670 CCCCGTCTATGAAATGGGGACGG - Intronic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1005431683 6:25764205-25764227 CCTCATTTGTGGAATCTGAATGG + Intronic
1005931326 6:30486704-30486726 CTTCATCTGTGGGATGCTGAAGG + Intergenic
1006005146 6:30996084-30996106 GCTCATCTATGGAATGGAGATGG + Intergenic
1006069870 6:31490572-31490594 GCACATGTGAGGAATGGGGAGGG + Intergenic
1006181745 6:32157704-32157726 TCTCACCTGTGGCATTGGGATGG - Exonic
1006456363 6:34134217-34134239 CCTCATCTCTGTAATGGGATTGG - Intronic
1006694465 6:35920186-35920208 CCTCCTCTGTGGAGTTGGGGAGG + Intronic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1007012517 6:38431420-38431442 CCTCATCTGTGAAACTGGGTTGG - Intronic
1007021726 6:38528050-38528072 CCACTACTGGGGAATGGGGAAGG - Intronic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007217279 6:40250132-40250154 CTTCATCTGTGAAATGGGTGTGG + Intergenic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007386748 6:41525153-41525175 CCTCGGCTGAGGAATTGGGAAGG - Intergenic
1007397782 6:41587322-41587344 CCCCAGCTGTGGAAGGGCGAGGG + Exonic
1007420452 6:41716156-41716178 CCTCCTCTGTGAGATGGAGATGG - Intronic
1007638017 6:43311973-43311995 CTTCATCTGGGTAATGGGGTAGG + Intronic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007811463 6:44489157-44489179 GCTCATCTGTGAAATAGGGATGG - Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008857763 6:56112505-56112527 CCTCTGCTGGGGAAGGGGGAGGG - Intronic
1009020794 6:57946572-57946594 CCACATCTGTGGAATCAGGGCGG + Intergenic
1010084998 6:71906753-71906775 TCTTATTTGTGAAATGGGGATGG + Intronic
1011033387 6:82946170-82946192 ACTCATCTGTGGAATCTGGTTGG - Intronic
1011472111 6:87718260-87718282 CCTTATCTTTGAAATAGGGATGG + Intergenic
1011752619 6:90468554-90468576 CCACATATGGGGTATGGGGAAGG - Intergenic
1012637593 6:101564271-101564293 GCACAGCTGTGGCATGGGGATGG + Intronic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013139054 6:107312521-107312543 CCCCATCTGTTAAATGGGGATGG + Intronic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013453684 6:110310447-110310469 TCTCATGTCTGGAGTGGGGAAGG - Intronic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1014388527 6:120831646-120831668 CCTCATATTTGAAATAGGGATGG - Intergenic
1015267913 6:131307631-131307653 TCTTGTCTGTGGAATAGGGAGGG - Intergenic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1016388802 6:143554580-143554602 CCTCACCTGAGGAAAGGTGAAGG + Intronic
1017094968 6:150796742-150796764 CTTCATCTATGAAATGGGGAAGG - Intronic
1017324863 6:153132183-153132205 CCACATCTGTGGGAAGAGGAGGG + Intergenic
1017958098 6:159196192-159196214 CCTCACCTCTGGAGTTGGGAGGG + Intronic
1017971315 6:159314931-159314953 CCTAATCTGTGAAATCAGGAAGG + Intergenic
1019501413 7:1366701-1366723 CTTCCTCTGTAGAATGGGGTGGG - Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020030450 7:4929233-4929255 TCTCATCTGTCGAATGGGCTCGG - Intronic
1020032609 7:4943466-4943488 TCTCTTCTGTGAAATGGGTAGGG - Intronic
1020127138 7:5539284-5539306 CCTCAGCTGTGAAAAGGGGCAGG + Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020151714 7:5686964-5686986 CCTCCTGTGTGGCCTGGGGATGG + Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1023354310 7:39351783-39351805 CCTCATGTGTGAAATGGAGCTGG - Intronic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023642829 7:42277923-42277945 CCACAGCTGTAGAATGGAGAAGG + Intergenic
1023805677 7:43871243-43871265 CCTAATCAGAGGAAAGGGGAAGG + Intronic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1024244106 7:47456414-47456436 CCCCACCTGGGGAATGGGGGTGG + Intronic
1024918004 7:54525249-54525271 CCCAAACTGTGGAAGGGGGAAGG - Intergenic
1026015714 7:66669308-66669330 CCTCCTCTGGTGACTGGGGAGGG - Intronic
1026264606 7:68785268-68785290 GCTCAGCTGAGGAATGAGGAAGG - Intergenic
1026559113 7:71433348-71433370 CCCCATCTGTGGAGGAGGGATGG + Intronic
1026849768 7:73717478-73717500 TCCCATCTGTGAAGTGGGGATGG - Intronic
1027163645 7:75819908-75819930 CCTCATCTATGAAATGGTGGGGG + Intronic
1028137559 7:87238297-87238319 CTTGATCTGTCAAATGGGGATGG + Intergenic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029464925 7:100719569-100719591 CCTCATCTGTCAAATGGGTGTGG - Intergenic
1029585633 7:101468977-101468999 TCTCATCTGTGAAATGGGGTTGG + Intronic
1030079901 7:105768275-105768297 GCCCATCTATGGAATGGGTATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1031492605 7:122407499-122407521 TTTCATATGTGAAATGGGGAGGG - Intronic
1031570373 7:123351644-123351666 CCTCATCTGTGAAATAGGAGGGG + Intergenic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032675374 7:134125375-134125397 TCTCATCTGTCTAATGAGGATGG + Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033685015 7:143630959-143630981 CAGCATCTGTGGAAAGGTGAAGG + Intronic
1033688188 7:143710178-143710200 CAGCATCTGTGGAAAGGTGAAGG + Intronic
1033699598 7:143826662-143826684 CAGCATCTGTGGAAAGGTGAAGG - Intergenic
1033993772 7:147320160-147320182 CCTGCTGTATGGAATGGGGATGG - Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035080160 7:156209114-156209136 CCGCATCTGTGGCAAAGGGAAGG + Intergenic
1035232017 7:157470852-157470874 CCTCATCTGTTAAATGGAAATGG - Intergenic
1036107950 8:5861974-5861996 CATCATCTTTTGGATGGGGAAGG + Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1036959801 8:13231668-13231690 CCTCATCTGTTAAATGGAGGTGG - Intronic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1037748322 8:21663593-21663615 TCTCATCTGTCAAATGGAGATGG - Intergenic
1037801628 8:22039093-22039115 CCTCATCTGGGAAATGGGGCTGG - Intergenic
1037941939 8:22958192-22958214 CCACATCTTTGGAGAGGGGAGGG - Intronic
1040981157 8:53247383-53247405 CCTCATCTGTTAAGTGGGTATGG + Intronic
1042113594 8:65407888-65407910 CCTCATCTCTGAACTGGGGAAGG - Intergenic
1042692993 8:71524224-71524246 CCTCATCTGGTAAATTGGGAGGG - Intronic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1043651033 8:82592386-82592408 CCTCACATGTGGAAAGGGCAAGG + Intergenic
1043663406 8:82776242-82776264 CTTCATTTGTGAAATGGAGATGG - Intergenic
1043933664 8:86118862-86118884 CCTCATCCTTAGAATGGTGATGG - Intronic
1043950087 8:86298975-86298997 CCTTATTGGTGGAATGGGGGTGG + Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044844314 8:96365402-96365424 CCTCATCTATAAAATAGGGATGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1044999981 8:97870175-97870197 CCTCATCTGTCTAATGAGGATGG + Intronic
1045051455 8:98330887-98330909 CCTCATCAGTCAAATGGAGAGGG - Intergenic
1045294610 8:100862405-100862427 CCTCATCTGAGGATGGGTGATGG - Intergenic
1045375735 8:101572003-101572025 CCTTAGCTGTGAAATGAGGAAGG + Intronic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045566253 8:103319113-103319135 CCTAAACTGGGGAAAGGGGAAGG + Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1045998819 8:108395528-108395550 CTGGATCTGTGGAATGGGGATGG - Intronic
1046373042 8:113336580-113336602 CCCCAGCAGTGGAATGGGAAGGG + Intronic
1046817593 8:118601783-118601805 CTTCATCTTTGGAGTAGGGATGG - Intronic
1047125558 8:121955791-121955813 CCTCCTCTGTGGAAAGGCAAAGG - Intergenic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047218867 8:122902432-122902454 CCTCAGCTGTACATTGGGGATGG + Intronic
1047254660 8:123206504-123206526 CTCCACCTGTGGAATGTGGAGGG - Intronic
1047301927 8:123620935-123620957 TCCCATCTGTAGAATGGGAATGG + Intergenic
1047696339 8:127407010-127407032 ACACATCTGTGGATTGGGGCTGG + Intergenic
1047774642 8:128059755-128059777 CCCCATGTGTAAAATGGGGATGG - Intergenic
1047777692 8:128087143-128087165 CCTCATCTGTGAAAAAGGGGTGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1047863400 8:128993925-128993947 CCTGATCTTTGGAAGGCGGAAGG + Intergenic
1048354582 8:133642788-133642810 CCCCACCTGTGGAAGGCGGAAGG + Intergenic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048569937 8:135643810-135643832 CCTTATCTGTCAAATGGGTATGG + Intronic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1049708011 8:144051661-144051683 CCCCCTCTGTGGGATGGGGCCGG + Intronic
1049991775 9:998249-998271 CCTCATCTACGAAATGGGAATGG - Intergenic
1050459662 9:5866880-5866902 CCTCATCTGTAAAATGGGACTGG + Intergenic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051296493 9:15601423-15601445 CCTCTTCTGTAGAATCTGGAAGG + Intronic
1051694420 9:19752785-19752807 CCTCATCTGTAGTATGGGCATGG - Intronic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053415793 9:37946100-37946122 CCTCATCTGTGCACTGCGTATGG - Intronic
1053419129 9:37965831-37965853 CCTCATCTGTACAGTGGGGGCGG + Intronic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1053887620 9:42656395-42656417 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054226642 9:62463845-62463867 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1054881877 9:70152433-70152455 CCTCATCTGTTAAATGGCGCTGG - Intronic
1055339704 9:75267860-75267882 AGTCAGCTGTGGAATGGGGCAGG - Intergenic
1055564461 9:77554130-77554152 CCTCATCTGGGAAACGGGAATGG + Intronic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056301314 9:85244703-85244725 CCTAATCTGTGGACTGGAGCAGG + Intergenic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057199350 9:93132109-93132131 TCTCATCTGTGAAATGGGTGTGG - Intronic
1057483156 9:95461626-95461648 CCTCATCTGTCAAATGGGACAGG - Intronic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1057702615 9:97374781-97374803 CCTCATCTATGAAATGAGCATGG + Intronic
1057719690 9:97522010-97522032 GCTCATCTGTGAAATGATGATGG - Intronic
1057726400 9:97571623-97571645 CCTCATCTGTGATACAGGGATGG - Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058702957 9:107615750-107615772 CCTCATTTGAGCAATGGAGATGG - Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058805445 9:108586799-108586821 CCTCATGTGTGAAATGGGGATGG - Intergenic
1058898231 9:109418431-109418453 GCTCATCTGTGGCATGGGGCAGG - Intronic
1058999879 9:110337366-110337388 CCCCAGATGTGGAATGGGGTGGG - Intronic
1059330357 9:113531402-113531424 ACTCATCTCTGAAATGGGGCTGG + Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059694344 9:116716497-116716519 TCCCATCTGTAGAATGGGAATGG + Intronic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1059923316 9:119181469-119181491 TCTTATCTGTCAAATGGGGAAGG + Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060087494 9:120715045-120715067 CCCCATCTCTGAAATGGGAATGG - Intergenic
1060141256 9:121212337-121212359 CCTCATCTGTAAAATAGGTATGG + Intronic
1060488092 9:124062351-124062373 CCCCATCTGTGAAATGGGAGTGG - Intergenic
1060514518 9:124257742-124257764 TCCCATCTCTGAAATGGGGAAGG + Intronic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061237393 9:129351021-129351043 CCCCCTCTGTGGGATGGGGCCGG - Intergenic
1061390215 9:130313485-130313507 CCTCGTCTGTGAAACGAGGAGGG + Intronic
1061501882 9:131008929-131008951 CCTCGTCTGTGGAGTGGGGTCGG - Intergenic
1061537089 9:131256946-131256968 CTTCGTCTGTGAAATGGGGGTGG + Intergenic
1061548163 9:131316666-131316688 CCTCACCTGGGGGAAGGGGAAGG - Intergenic
1061633328 9:131888258-131888280 CCTCATCTGTGAATTGGAAATGG - Intronic
1061673057 9:132200033-132200055 GGCCATCTGTAGAATGGGGATGG + Intronic
1061694172 9:132358637-132358659 GCACATCTTTGGAATCGGGAAGG - Intergenic
1061721158 9:132552202-132552224 CTGCATCTGTGAAGTGGGGATGG + Intronic
1061806717 9:133141041-133141063 CCCCATCTGTCAAATGGGCAAGG - Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1061946361 9:133910447-133910469 CCTCATCTGTCAAATGGGCTTGG - Intronic
1062010516 9:134264386-134264408 CCTCATCTCTGAAATGGGGATGG + Intergenic
1062099107 9:134718821-134718843 CTGCATCTGTGAAATGGGGATGG + Intronic
1062255358 9:135618239-135618261 CCACATCTGTAGAGTGGAGACGG - Intergenic
1062352921 9:136147982-136148004 CCTCATCTGTGAAATGGACCCGG - Intergenic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1187769943 X:22683873-22683895 ACTTATTTGTGAAATGGGGATGG + Intergenic
1187887962 X:23907279-23907301 CCTGATGTGTGGATGGGGGAGGG - Intronic
1188870718 X:35367594-35367616 CCTCACCTGCTGCATGGGGAAGG + Intergenic
1188928328 X:36073630-36073652 CCTCATCTGTGATATGAGGAAGG + Intronic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1189407966 X:40742927-40742949 CCTCACCTCTGGAAGGGGCAAGG + Intergenic
1189576731 X:42361667-42361689 CAACATTTGTGGAATGGGAATGG - Intergenic
1190180235 X:48185503-48185525 CATCATCTGGGGAATGCAGAGGG - Intergenic
1190197043 X:48328707-48328729 CGTCATCTGGGGAATGTGGAGGG + Intergenic
1190310671 X:49115016-49115038 CCTCATCTGTGAAATGGATGTGG - Intronic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190516611 X:51230204-51230226 CCTCATCTGTTGAGTGGGGCAGG - Intergenic
1190726229 X:53192645-53192667 CCTTGTCTCTGGAATGGTGATGG + Exonic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191866354 X:65706848-65706870 TCTCATCTATGAAGTGGGGATGG + Intronic
1192058025 X:67793103-67793125 CCTCTTCTGTGCCCTGGGGAGGG + Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192529974 X:71875408-71875430 CCTGAACTATGGGATGGGGATGG - Intergenic
1192551928 X:72061404-72061426 TCTCATACGTGCAATGGGGATGG + Intergenic
1193169110 X:78315666-78315688 TCTCTGCTTTGGAATGGGGAGGG + Intronic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1194236600 X:91391904-91391926 CCTAATCTGTGGGGAGGGGAAGG + Intergenic
1194526357 X:94982787-94982809 CCTCTGCTGGGGCATGGGGAGGG - Intergenic
1195332877 X:103820044-103820066 CCAGCTCTGTGGAAGGGGGAAGG - Intergenic
1195676689 X:107512182-107512204 CCCCATCTGTGAGATGGGGAGGG + Intergenic
1195916014 X:109936045-109936067 CCTCATCTGTAATATAGGGATGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197593649 X:128441006-128441028 CCACATCTGAGGACTGGGGCTGG + Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198439506 X:136648661-136648683 CCACATCTGAGAAATGGGGATGG + Intronic
1198578580 X:138037447-138037469 CTTCATCTGTGGAAAGAAGAGGG + Intergenic
1199139014 X:144288013-144288035 CCTCTTCTGGGGGATGGGGGAGG + Intergenic
1199438541 X:147841991-147842013 CTTCATCTGGGGAATGGGGGAGG - Intergenic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1200231155 X:154444520-154444542 TCTCATCTGTGAAATGGGCCTGG + Intronic
1200242899 X:154507081-154507103 CCTCATAGCTGGACTGGGGACGG + Intronic
1200375419 X:155774799-155774821 CCTCATCTTTGGAGAGGGGGAGG + Exonic