ID: 1001403821

View in Genome Browser
Species Human (GRCh38)
Location 5:171461995-171462017
Sequence TAGGATGTGCATTTTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001403820_1001403821 -6 Left 1001403820 5:171461978-171462000 CCTGGCAAGATAGATGTTAGGAT No data
Right 1001403821 5:171461995-171462017 TAGGATGTGCATTTTGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001403821 Original CRISPR TAGGATGTGCATTTTGTAGA TGG Intergenic
No off target data available for this crispr