ID: 1001404929

View in Genome Browser
Species Human (GRCh38)
Location 5:171469515-171469537
Sequence TTGACTCAGCCTGGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001404929_1001404935 8 Left 1001404929 5:171469515-171469537 CCTTCCTCCCCAGGCTGAGTCAA No data
Right 1001404935 5:171469546-171469568 TATTCTATTACATGTAATTGAGG No data
1001404929_1001404936 15 Left 1001404929 5:171469515-171469537 CCTTCCTCCCCAGGCTGAGTCAA No data
Right 1001404936 5:171469553-171469575 TTACATGTAATTGAGGTAAAAGG No data
1001404929_1001404937 16 Left 1001404929 5:171469515-171469537 CCTTCCTCCCCAGGCTGAGTCAA No data
Right 1001404937 5:171469554-171469576 TACATGTAATTGAGGTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001404929 Original CRISPR TTGACTCAGCCTGGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr