ID: 1001406324

View in Genome Browser
Species Human (GRCh38)
Location 5:171479982-171480004
Sequence CCTTCCTGGGGAGGGTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001406310_1001406324 15 Left 1001406310 5:171479944-171479966 CCACCTAGTGCCCCACACTCATG No data
Right 1001406324 5:171479982-171480004 CCTTCCTGGGGAGGGTCCCCTGG No data
1001406311_1001406324 12 Left 1001406311 5:171479947-171479969 CCTAGTGCCCCACACTCATGTTA No data
Right 1001406324 5:171479982-171480004 CCTTCCTGGGGAGGGTCCCCTGG No data
1001406312_1001406324 5 Left 1001406312 5:171479954-171479976 CCCCACACTCATGTTACCTGAAC No data
Right 1001406324 5:171479982-171480004 CCTTCCTGGGGAGGGTCCCCTGG No data
1001406314_1001406324 3 Left 1001406314 5:171479956-171479978 CCACACTCATGTTACCTGAACTC No data
Right 1001406324 5:171479982-171480004 CCTTCCTGGGGAGGGTCCCCTGG No data
1001406305_1001406324 29 Left 1001406305 5:171479930-171479952 CCCCTCTCCCTTTACCACCTAGT No data
Right 1001406324 5:171479982-171480004 CCTTCCTGGGGAGGGTCCCCTGG No data
1001406306_1001406324 28 Left 1001406306 5:171479931-171479953 CCCTCTCCCTTTACCACCTAGTG No data
Right 1001406324 5:171479982-171480004 CCTTCCTGGGGAGGGTCCCCTGG No data
1001406308_1001406324 22 Left 1001406308 5:171479937-171479959 CCCTTTACCACCTAGTGCCCCAC No data
Right 1001406324 5:171479982-171480004 CCTTCCTGGGGAGGGTCCCCTGG No data
1001406309_1001406324 21 Left 1001406309 5:171479938-171479960 CCTTTACCACCTAGTGCCCCACA No data
Right 1001406324 5:171479982-171480004 CCTTCCTGGGGAGGGTCCCCTGG No data
1001406313_1001406324 4 Left 1001406313 5:171479955-171479977 CCCACACTCATGTTACCTGAACT No data
Right 1001406324 5:171479982-171480004 CCTTCCTGGGGAGGGTCCCCTGG No data
1001406307_1001406324 27 Left 1001406307 5:171479932-171479954 CCTCTCCCTTTACCACCTAGTGC No data
Right 1001406324 5:171479982-171480004 CCTTCCTGGGGAGGGTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001406324 Original CRISPR CCTTCCTGGGGAGGGTCCCC TGG Intergenic