ID: 1001406528

View in Genome Browser
Species Human (GRCh38)
Location 5:171481003-171481025
Sequence GGTCCCAGTGGAGCCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001406528_1001406541 23 Left 1001406528 5:171481003-171481025 CCACCTGGGGCTCCACTGGGACC No data
Right 1001406541 5:171481049-171481071 GGGTGGGCAGAACCATAGAAAGG No data
1001406528_1001406532 -10 Left 1001406528 5:171481003-171481025 CCACCTGGGGCTCCACTGGGACC No data
Right 1001406532 5:171481016-171481038 CACTGGGACCGAAGAGACTCGGG No data
1001406528_1001406537 2 Left 1001406528 5:171481003-171481025 CCACCTGGGGCTCCACTGGGACC No data
Right 1001406537 5:171481028-171481050 AGAGACTCGGGTCGGGGTGCAGG No data
1001406528_1001406538 3 Left 1001406528 5:171481003-171481025 CCACCTGGGGCTCCACTGGGACC No data
Right 1001406538 5:171481029-171481051 GAGACTCGGGTCGGGGTGCAGGG No data
1001406528_1001406534 -5 Left 1001406528 5:171481003-171481025 CCACCTGGGGCTCCACTGGGACC No data
Right 1001406534 5:171481021-171481043 GGACCGAAGAGACTCGGGTCGGG No data
1001406528_1001406535 -4 Left 1001406528 5:171481003-171481025 CCACCTGGGGCTCCACTGGGACC No data
Right 1001406535 5:171481022-171481044 GACCGAAGAGACTCGGGTCGGGG No data
1001406528_1001406540 7 Left 1001406528 5:171481003-171481025 CCACCTGGGGCTCCACTGGGACC No data
Right 1001406540 5:171481033-171481055 CTCGGGTCGGGGTGCAGGGTGGG No data
1001406528_1001406539 6 Left 1001406528 5:171481003-171481025 CCACCTGGGGCTCCACTGGGACC No data
Right 1001406539 5:171481032-171481054 ACTCGGGTCGGGGTGCAGGGTGG No data
1001406528_1001406533 -6 Left 1001406528 5:171481003-171481025 CCACCTGGGGCTCCACTGGGACC No data
Right 1001406533 5:171481020-171481042 GGGACCGAAGAGACTCGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001406528 Original CRISPR GGTCCCAGTGGAGCCCCAGG TGG (reversed) Intergenic
No off target data available for this crispr