ID: 1001408620

View in Genome Browser
Species Human (GRCh38)
Location 5:171494925-171494947
Sequence GGCCCAGGGAAGCCCCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001408620_1001408629 4 Left 1001408620 5:171494925-171494947 CCTACAAGGGGCTTCCCTGGGCC No data
Right 1001408629 5:171494952-171494974 GGCTGGAACAAACTGCCCAGAGG No data
1001408620_1001408630 5 Left 1001408620 5:171494925-171494947 CCTACAAGGGGCTTCCCTGGGCC No data
Right 1001408630 5:171494953-171494975 GCTGGAACAAACTGCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001408620 Original CRISPR GGCCCAGGGAAGCCCCTTGT AGG (reversed) Intergenic
No off target data available for this crispr