ID: 1001413862

View in Genome Browser
Species Human (GRCh38)
Location 5:171529373-171529395
Sequence GGATGAACCCAGTGTCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001413862_1001413866 2 Left 1001413862 5:171529373-171529395 CCCAGCAGACACTGGGTTCATCC No data
Right 1001413866 5:171529398-171529420 CTGTATCCTCTAAATCTCTTGGG No data
1001413862_1001413865 1 Left 1001413862 5:171529373-171529395 CCCAGCAGACACTGGGTTCATCC No data
Right 1001413865 5:171529397-171529419 GCTGTATCCTCTAAATCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001413862 Original CRISPR GGATGAACCCAGTGTCTGCT GGG (reversed) Intergenic
No off target data available for this crispr