ID: 1001414482

View in Genome Browser
Species Human (GRCh38)
Location 5:171535301-171535323
Sequence CTGTGGGGGCAGGAGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001414475_1001414482 0 Left 1001414475 5:171535278-171535300 CCAGTAATTCAGAAGATTCAGGA No data
Right 1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG No data
1001414473_1001414482 16 Left 1001414473 5:171535262-171535284 CCATAATTAAGCATGACCAGTAA No data
Right 1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001414482 Original CRISPR CTGTGGGGGCAGGAGAAGGA TGG Intergenic
No off target data available for this crispr