ID: 1001415725

View in Genome Browser
Species Human (GRCh38)
Location 5:171543778-171543800
Sequence GGCCTGTGGAAACACAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001415720_1001415725 1 Left 1001415720 5:171543754-171543776 CCATGCAGTCACTACTCAGCTAG No data
Right 1001415725 5:171543778-171543800 GGCCTGTGGAAACACAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001415725 Original CRISPR GGCCTGTGGAAACACAGCAA AGG Intergenic
No off target data available for this crispr