ID: 1001418975

View in Genome Browser
Species Human (GRCh38)
Location 5:171572512-171572534
Sequence CATTCGGTGTGGCGGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001418975_1001418979 -9 Left 1001418975 5:171572512-171572534 CCATCCATCCGCCACACCGAATG No data
Right 1001418979 5:171572526-171572548 CACCGAATGAACAATCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001418975 Original CRISPR CATTCGGTGTGGCGGATGGA TGG (reversed) Intergenic
No off target data available for this crispr