ID: 1001420812

View in Genome Browser
Species Human (GRCh38)
Location 5:171585929-171585951
Sequence CTGTTGGTCTGTAGGTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001420802_1001420812 24 Left 1001420802 5:171585882-171585904 CCTTTCCATATTCTCCTGTTAGT No data
Right 1001420812 5:171585929-171585951 CTGTTGGTCTGTAGGTCAGCTGG No data
1001420798_1001420812 30 Left 1001420798 5:171585876-171585898 CCCCCTCCTTTCCATATTCTCCT No data
Right 1001420812 5:171585929-171585951 CTGTTGGTCTGTAGGTCAGCTGG No data
1001420800_1001420812 28 Left 1001420800 5:171585878-171585900 CCCTCCTTTCCATATTCTCCTGT No data
Right 1001420812 5:171585929-171585951 CTGTTGGTCTGTAGGTCAGCTGG No data
1001420807_1001420812 10 Left 1001420807 5:171585896-171585918 CCTGTTAGTGTCTGGGAAGGTTG No data
Right 1001420812 5:171585929-171585951 CTGTTGGTCTGTAGGTCAGCTGG No data
1001420803_1001420812 19 Left 1001420803 5:171585887-171585909 CCATATTCTCCTGTTAGTGTCTG No data
Right 1001420812 5:171585929-171585951 CTGTTGGTCTGTAGGTCAGCTGG No data
1001420799_1001420812 29 Left 1001420799 5:171585877-171585899 CCCCTCCTTTCCATATTCTCCTG No data
Right 1001420812 5:171585929-171585951 CTGTTGGTCTGTAGGTCAGCTGG No data
1001420801_1001420812 27 Left 1001420801 5:171585879-171585901 CCTCCTTTCCATATTCTCCTGTT No data
Right 1001420812 5:171585929-171585951 CTGTTGGTCTGTAGGTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001420812 Original CRISPR CTGTTGGTCTGTAGGTCAGC TGG Intergenic
No off target data available for this crispr