ID: 1001429299

View in Genome Browser
Species Human (GRCh38)
Location 5:171646825-171646847
Sequence TTCTCTCAGCCAGAGAACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001429299_1001429301 3 Left 1001429299 5:171646825-171646847 CCCGAGTTCTCTGGCTGAGAGAA No data
Right 1001429301 5:171646851-171646873 GAGTTGCTGCCACTGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001429299 Original CRISPR TTCTCTCAGCCAGAGAACTC GGG (reversed) Intergenic
No off target data available for this crispr