ID: 1001429541

View in Genome Browser
Species Human (GRCh38)
Location 5:171648409-171648431
Sequence CCAGCCAGTGGTTATCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001429541_1001429549 30 Left 1001429541 5:171648409-171648431 CCAGATGGATAACCACTGGCTGG No data
Right 1001429549 5:171648462-171648484 GCCCTCCCCAGGAGAAGAGAGGG No data
1001429541_1001429548 29 Left 1001429541 5:171648409-171648431 CCAGATGGATAACCACTGGCTGG No data
Right 1001429548 5:171648461-171648483 TGCCCTCCCCAGGAGAAGAGAGG No data
1001429541_1001429546 19 Left 1001429541 5:171648409-171648431 CCAGATGGATAACCACTGGCTGG No data
Right 1001429546 5:171648451-171648473 CACTTCCTCTTGCCCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001429541 Original CRISPR CCAGCCAGTGGTTATCCATC TGG (reversed) Intergenic