ID: 1001431863

View in Genome Browser
Species Human (GRCh38)
Location 5:171668258-171668280
Sequence CCAGTTCTCCAGGTCTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001431863_1001431870 6 Left 1001431863 5:171668258-171668280 CCAGTGTAGACCTGGAGAACTGG No data
Right 1001431870 5:171668287-171668309 GTGGCCTCTGCAAAGGGGACAGG No data
1001431863_1001431869 1 Left 1001431863 5:171668258-171668280 CCAGTGTAGACCTGGAGAACTGG No data
Right 1001431869 5:171668282-171668304 AATGCGTGGCCTCTGCAAAGGGG No data
1001431863_1001431868 0 Left 1001431863 5:171668258-171668280 CCAGTGTAGACCTGGAGAACTGG No data
Right 1001431868 5:171668281-171668303 AAATGCGTGGCCTCTGCAAAGGG No data
1001431863_1001431867 -1 Left 1001431863 5:171668258-171668280 CCAGTGTAGACCTGGAGAACTGG No data
Right 1001431867 5:171668280-171668302 GAAATGCGTGGCCTCTGCAAAGG No data
1001431863_1001431872 15 Left 1001431863 5:171668258-171668280 CCAGTGTAGACCTGGAGAACTGG No data
Right 1001431872 5:171668296-171668318 GCAAAGGGGACAGGCACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001431863 Original CRISPR CCAGTTCTCCAGGTCTACAC TGG (reversed) Intergenic
No off target data available for this crispr