ID: 1001433396

View in Genome Browser
Species Human (GRCh38)
Location 5:171681212-171681234
Sequence GGCTGAGGGTGTGCCCGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001433396_1001433401 -4 Left 1001433396 5:171681212-171681234 CCACGTCGGGCACACCCTCAGCC No data
Right 1001433401 5:171681231-171681253 AGCCACCACAGTGTCCTGGAGGG No data
1001433396_1001433409 28 Left 1001433396 5:171681212-171681234 CCACGTCGGGCACACCCTCAGCC No data
Right 1001433409 5:171681263-171681285 TGTGTCCATCCTGGAGTCCAAGG No data
1001433396_1001433407 19 Left 1001433396 5:171681212-171681234 CCACGTCGGGCACACCCTCAGCC No data
Right 1001433407 5:171681254-171681276 AGGGCCGAGTGTGTCCATCCTGG No data
1001433396_1001433403 -1 Left 1001433396 5:171681212-171681234 CCACGTCGGGCACACCCTCAGCC No data
Right 1001433403 5:171681234-171681256 CACCACAGTGTCCTGGAGGGAGG No data
1001433396_1001433404 0 Left 1001433396 5:171681212-171681234 CCACGTCGGGCACACCCTCAGCC No data
Right 1001433404 5:171681235-171681257 ACCACAGTGTCCTGGAGGGAGGG No data
1001433396_1001433400 -5 Left 1001433396 5:171681212-171681234 CCACGTCGGGCACACCCTCAGCC No data
Right 1001433400 5:171681230-171681252 CAGCCACCACAGTGTCCTGGAGG No data
1001433396_1001433399 -8 Left 1001433396 5:171681212-171681234 CCACGTCGGGCACACCCTCAGCC No data
Right 1001433399 5:171681227-171681249 CCTCAGCCACCACAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001433396 Original CRISPR GGCTGAGGGTGTGCCCGACG TGG (reversed) Intergenic