ID: 1001433403

View in Genome Browser
Species Human (GRCh38)
Location 5:171681234-171681256
Sequence CACCACAGTGTCCTGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001433396_1001433403 -1 Left 1001433396 5:171681212-171681234 CCACGTCGGGCACACCCTCAGCC No data
Right 1001433403 5:171681234-171681256 CACCACAGTGTCCTGGAGGGAGG No data
1001433393_1001433403 17 Left 1001433393 5:171681194-171681216 CCAAGGCAGGCAGTGAGACCACG No data
Right 1001433403 5:171681234-171681256 CACCACAGTGTCCTGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001433403 Original CRISPR CACCACAGTGTCCTGGAGGG AGG Intergenic