ID: 1001433591

View in Genome Browser
Species Human (GRCh38)
Location 5:171682522-171682544
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001433591_1001433594 20 Left 1001433591 5:171682522-171682544 CCCTGCTTCAGCTGTGCTTTCAG No data
Right 1001433594 5:171682565-171682587 AGATGACGCCACTCTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001433591 Original CRISPR CTGAAAGCACAGCTGAAGCA GGG (reversed) Intergenic
No off target data available for this crispr