ID: 1001433805

View in Genome Browser
Species Human (GRCh38)
Location 5:171683904-171683926
Sequence TAGGGCAAACAGGAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001433805_1001433818 26 Left 1001433805 5:171683904-171683926 CCCACCTCCTCCTGTTTGCCCTA No data
Right 1001433818 5:171683953-171683975 GAAACCAGTGTTTGGTACGATGG No data
1001433805_1001433817 18 Left 1001433805 5:171683904-171683926 CCCACCTCCTCCTGTTTGCCCTA No data
Right 1001433817 5:171683945-171683967 TTTTCTAGGAAACCAGTGTTTGG No data
1001433805_1001433819 27 Left 1001433805 5:171683904-171683926 CCCACCTCCTCCTGTTTGCCCTA No data
Right 1001433819 5:171683954-171683976 AAACCAGTGTTTGGTACGATGGG No data
1001433805_1001433814 4 Left 1001433805 5:171683904-171683926 CCCACCTCCTCCTGTTTGCCCTA No data
Right 1001433814 5:171683931-171683953 GTAAGTGTACCCAGTTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001433805 Original CRISPR TAGGGCAAACAGGAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr