ID: 1001434743

View in Genome Browser
Species Human (GRCh38)
Location 5:171691367-171691389
Sequence GGTTTGAGAGGACACCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001434743_1001434748 5 Left 1001434743 5:171691367-171691389 CCTCCTTGGTGTCCTCTCAAACC No data
Right 1001434748 5:171691395-171691417 CTGTAATAGATGACTTCAAGAGG No data
1001434743_1001434750 16 Left 1001434743 5:171691367-171691389 CCTCCTTGGTGTCCTCTCAAACC No data
Right 1001434750 5:171691406-171691428 GACTTCAAGAGGCGCATGGATGG No data
1001434743_1001434749 12 Left 1001434743 5:171691367-171691389 CCTCCTTGGTGTCCTCTCAAACC No data
Right 1001434749 5:171691402-171691424 AGATGACTTCAAGAGGCGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001434743 Original CRISPR GGTTTGAGAGGACACCAAGG AGG (reversed) Intergenic
No off target data available for this crispr