ID: 1001435696

View in Genome Browser
Species Human (GRCh38)
Location 5:171697607-171697629
Sequence GGGAGTGAGGCCTCACTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001435696_1001435708 25 Left 1001435696 5:171697607-171697629 CCTCTAAGTGAGGCCTCACTCCC No data
Right 1001435708 5:171697655-171697677 ACAAGCAGTCGGGCCCCACCTGG No data
1001435696_1001435701 -5 Left 1001435696 5:171697607-171697629 CCTCTAAGTGAGGCCTCACTCCC No data
Right 1001435701 5:171697625-171697647 CTCCCCAGGCAGGCTTATGAGGG No data
1001435696_1001435707 15 Left 1001435696 5:171697607-171697629 CCTCTAAGTGAGGCCTCACTCCC No data
Right 1001435707 5:171697645-171697667 GGGGCTGAGAACAAGCAGTCGGG No data
1001435696_1001435700 -6 Left 1001435696 5:171697607-171697629 CCTCTAAGTGAGGCCTCACTCCC No data
Right 1001435700 5:171697624-171697646 ACTCCCCAGGCAGGCTTATGAGG No data
1001435696_1001435702 -4 Left 1001435696 5:171697607-171697629 CCTCTAAGTGAGGCCTCACTCCC No data
Right 1001435702 5:171697626-171697648 TCCCCAGGCAGGCTTATGAGGGG No data
1001435696_1001435706 14 Left 1001435696 5:171697607-171697629 CCTCTAAGTGAGGCCTCACTCCC No data
Right 1001435706 5:171697644-171697666 AGGGGCTGAGAACAAGCAGTCGG No data
1001435696_1001435709 26 Left 1001435696 5:171697607-171697629 CCTCTAAGTGAGGCCTCACTCCC No data
Right 1001435709 5:171697656-171697678 CAAGCAGTCGGGCCCCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001435696 Original CRISPR GGGAGTGAGGCCTCACTTAG AGG (reversed) Intergenic